Irene Campi
Irene Campi
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Search for other papers by Irene Campi in
Google Scholar
PubMed
Search for other papers by Irene Campi in
Google Scholar
PubMed
Maura Agostini
Maura Agostini
Wellcome Trust-MRC Institute of Metabolic Science, University of Cambridge, Cambridge, United Kingdom
Search for other papers by Maura Agostini in
Google Scholar
PubMed
Search for other papers by Maura Agostini in
Google Scholar
PubMed
Federica Marelli
Federica Marelli
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Search for other papers by Federica Marelli in
Google Scholar
PubMed
Search for other papers by Federica Marelli in
Google Scholar
PubMed
Tiziana de Filippis
Tiziana de Filippis
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Search for other papers by Tiziana de Filippis in
Google Scholar
PubMed
Search for other papers by Tiziana de Filippis in
Google Scholar
PubMed
Beatriz Romartinez-Alonso
Beatriz Romartinez-Alonso
Department of Molecular and Cell Biology, Leicester Institute of Structural and Chemical Biology, University of Leicester, Leicester, United Kingdom
Search for other papers by Beatriz Romartinez-Alonso in
Google Scholar
PubMed
Search for other papers by Beatriz Romartinez-Alonso in
Google Scholar
PubMed
Odelia Rajanayagam
Odelia Rajanayagam
Wellcome Trust-MRC Institute of Metabolic Science, University of Cambridge, Cambridge, United Kingdom
Search for other papers by Odelia Rajanayagam in
Google Scholar
PubMed
Search for other papers by Odelia Rajanayagam in
Google Scholar
PubMed
Giuditta Rurale
Giuditta Rurale
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Search for other papers by Giuditta Rurale in
Google Scholar
PubMed
Search for other papers by Giuditta Rurale in
Google Scholar
PubMed
Ilaria Gentile
Ilaria Gentile
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Ilaria Gentile in
Google Scholar
PubMed
Search for other papers by Ilaria Gentile in
Google Scholar
PubMed
Federica Spagnolo
Federica Spagnolo
Unit of Endocrinology, University Hospital “G. Martino”, Messina, Italy
Search for other papers by Federica Spagnolo in
Google Scholar
PubMed
Search for other papers by Federica Spagnolo in
Google Scholar
PubMed
Massimiliano Andreasi
Massimiliano Andreasi
Laboratorio Analisi Cliniche, Centro di Ricerche e Tecnologie Biomediche, IRCCS Istituto Auxologico Italiano, Cusano Milanino, Italy
Search for other papers by Massimiliano Andreasi in
Google Scholar
PubMed
Search for other papers by Massimiliano Andreasi in
Google Scholar
PubMed
Francesco Ferraù
Francesco Ferraù
Unit of Endocrinology, University Hospital “G. Martino”, Messina, Italy
Department of Human Pathology of Adulthood and Childhood, University of Messina, Messina, Italy
Search for other papers by Francesco Ferraù in
Google Scholar
PubMed
Department of Human Pathology of Adulthood and Childhood, University of Messina, Messina, Italy
Search for other papers by Francesco Ferraù in
Google Scholar
PubMed
Salvatore Cannavò
Salvatore Cannavò
Unit of Endocrinology, University Hospital “G. Martino”, Messina, Italy
Department of Human Pathology of Adulthood and Childhood, University of Messina, Messina, Italy
Search for other papers by Salvatore Cannavò in
Google Scholar
PubMed
Department of Human Pathology of Adulthood and Childhood, University of Messina, Messina, Italy
Search for other papers by Salvatore Cannavò in
Google Scholar
PubMed
Laura Fugazzola
Laura Fugazzola
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Department of Pathophysiology and Transplantation, University of Milan, Milan, Italy
Search for other papers by Laura Fugazzola in
Google Scholar
PubMed
Department of Pathophysiology and Transplantation, University of Milan, Milan, Italy
Search for other papers by Laura Fugazzola in
Google Scholar
PubMed
Krishna V. Chatterjee
Krishna V. Chatterjee
Wellcome Trust-MRC Institute of Metabolic Science, University of Cambridge, Cambridge, United Kingdom
Search for other papers by Krishna V. Chatterjee in
Google Scholar
PubMed
Search for other papers by Krishna V. Chatterjee in
Google Scholar
PubMed
Luca Persani
Luca Persani
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, Istituto Di Ricovero e Cura a Carattere Scientifico (IRCCS), Milan, Italy
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Established Facts Resistance to thyroid hormone (RTHβ) syndrome is caused by dominant negative variants in the THRB gene. Pathogenic variants recur within 3 hot spots in the ligand-binding domain involving the amino acid
Manassawee Korwutthikulrangsri
Manassawee Korwutthikulrangsri
Department of Medicine, University of Chicago, Chicago, Illinois, USA
Department of Pediatrics, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand
Search for other papers by Manassawee Korwutthikulrangsri in
Google Scholar
PubMed
Department of Pediatrics, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand
Search for other papers by Manassawee Korwutthikulrangsri in
Google Scholar
PubMed
Chrysoula Dosiou
Chrysoula Dosiou
Department of Medicine, Stanford University School of Medicine, Stanford, California, USA
Search for other papers by Chrysoula Dosiou in
Google Scholar
PubMed
Search for other papers by Chrysoula Dosiou in
Google Scholar
PubMed
Alexandra M. Dumitrescu
Alexandra M. Dumitrescu
Department of Medicine, University of Chicago, Chicago, Illinois, USA
Committee on Molecular Metabolism and Nutrition, University of Chicago, Chicago, Illinois, USA
Search for other papers by Alexandra M. Dumitrescu in
Google Scholar
PubMed
Committee on Molecular Metabolism and Nutrition, University of Chicago, Chicago, Illinois, USA
Search for other papers by Alexandra M. Dumitrescu in
Google Scholar
PubMed
Samuel Refetoff
Samuel Refetoff
Department of Medicine, University of Chicago, Chicago, Illinois, USA
Department of Pediatrics, University of Chicago, Chicago, Illinois, USA
Committee on Genetics, University of Chicago, Chicago, Illinois, USA
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
Department of Pediatrics, University of Chicago, Chicago, Illinois, USA
Committee on Genetics, University of Chicago, Chicago, Illinois, USA
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
What Is Known about This Topic? Mutations in the thyroid hormone receptor beta gene ( THRB ) in the region encoding the T3-binding and the adjacent hinge domains of the receptor have been reported to cause resistance to thyroid hormone
Alison-Michelle Naujack
Alison-Michelle Naujack
Institute for Human Genetics, Department of Epigenetics & Metabolism, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Alison-Michelle Naujack in
Google Scholar
PubMed
Search for other papers by Alison-Michelle Naujack in
Google Scholar
PubMed
Christin Krause
Christin Krause
Institute for Human Genetics, Department of Epigenetics & Metabolism, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Christin Krause in
Google Scholar
PubMed
Search for other papers by Christin Krause in
Google Scholar
PubMed
Jan H Britsemmer
Jan H Britsemmer
Institute for Human Genetics, Department of Epigenetics & Metabolism, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Jan H Britsemmer in
Google Scholar
PubMed
Search for other papers by Jan H Britsemmer in
Google Scholar
PubMed
Natalie Taege
Natalie Taege
Institute for Human Genetics, Department of Epigenetics & Metabolism, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Natalie Taege in
Google Scholar
PubMed
Search for other papers by Natalie Taege in
Google Scholar
PubMed
Jens Mittag
Jens Mittag
Institute for Experimental Endocrinology, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Jens Mittag in
Google Scholar
PubMed
Search for other papers by Jens Mittag in
Google Scholar
PubMed
Henriette Kirchner
Henriette Kirchner
Institute for Human Genetics, Department of Epigenetics & Metabolism, Center of Brain Behavior & Metabolism, University of Lübeck, Lübeck, Germany
Search for other papers by Henriette Kirchner in
Google Scholar
PubMed
Search for other papers by Henriette Kirchner in
Google Scholar
PubMed
) action ( 5 , 6 ). Previously, we have shown that the MASLD activity score (MAS) is associated with reduced TH receptor beta ( THRB ) expression in the liver of obese individuals ( 7 ). Additionally, hypothyroidism is a known risk factor for MASLD
João Anselmo
João Anselmo
Department of Endocrinology and Nutrition, Hospital Divino Espírito Santo, Ponta Delgada, Portugal
Search for other papers by João Anselmo in
Google Scholar
PubMed
Search for other papers by João Anselmo in
Google Scholar
PubMed
Carolina M. Chaves
Carolina M. Chaves
Department of Endocrinology and Nutrition, Hospital Divino Espírito Santo, Ponta Delgada, Portugal
Search for other papers by Carolina M. Chaves in
Google Scholar
PubMed
Search for other papers by Carolina M. Chaves in
Google Scholar
PubMed
levels of TH in mothers with resistance to thyroid hormone beta (RTHβ). This dominantly inherited disorder is characterized by reduced responsiveness to TH caused by mutations of the THRB gene. Affected individuals are mostly asymptomatic despite high
Alies A. van Mullem
Alies A. van Mullem
Department of Internal Medicine, Erasmus University Medical Centre, Rotterdam, The Netherlands
Search for other papers by Alies A. van Mullem in
Google Scholar
PubMed
Search for other papers by Alies A. van Mullem in
Google Scholar
PubMed
Theo J. Visser
Theo J. Visser
Department of Internal Medicine, Erasmus University Medical Centre, Rotterdam, The Netherlands
Search for other papers by Theo J. Visser in
Google Scholar
PubMed
Search for other papers by Theo J. Visser in
Google Scholar
PubMed
Robin P. Peeters
Robin P. Peeters
Department of Internal Medicine, Erasmus University Medical Centre, Rotterdam, The Netherlands
Search for other papers by Robin P. Peeters in
Google Scholar
PubMed
Search for other papers by Robin P. Peeters in
Google Scholar
PubMed
-dependent transcription factors [ 3 , 4 ]. Nongenomic effects of TH have also been reported [ 5 ], but those nongenomic actions are beyond the scope of this review. Different TR isoforms are generated from THRA and THRB by usage of alternative splice sites and
Yasmine Abdellaoui
Yasmine Abdellaoui
Department of Internal Medicine, Foch Hospital, Suresnes, France
Search for other papers by Yasmine Abdellaoui in
Google Scholar
PubMed
Search for other papers by Yasmine Abdellaoui in
Google Scholar
PubMed
Dimitra Magkou
Dimitra Magkou
Department of Endocrinology and Nutrition, Ambroise Paré Universitary Hospital, Assistance Publique Hôpitaux de Paris, Boulogne, France
Search for other papers by Dimitra Magkou in
Google Scholar
PubMed
Search for other papers by Dimitra Magkou in
Google Scholar
PubMed
Sofia Bakopoulou
Sofia Bakopoulou
Department of Endocrinology and Nutrition, Ambroise Paré Universitary Hospital, Assistance Publique Hôpitaux de Paris, Boulogne, France
Search for other papers by Sofia Bakopoulou in
Google Scholar
PubMed
Search for other papers by Sofia Bakopoulou in
Google Scholar
PubMed
Ramona Zaharia
Ramona Zaharia
Department of Endocrinology and Nutrition, Ambroise Paré Universitary Hospital, Assistance Publique Hôpitaux de Paris, Boulogne, France
Search for other papers by Ramona Zaharia in
Google Scholar
PubMed
Search for other papers by Ramona Zaharia in
Google Scholar
PubMed
Marie-Laure Raffin-Sanson
Marie-Laure Raffin-Sanson
Department of Endocrinology and Nutrition, Ambroise Paré Universitary Hospital, Assistance Publique Hôpitaux de Paris, Boulogne, France
EA 4340, Université Versailles Saint Quentin en Yvelines, UFR Simone Veil Santé, Montigny le Bretonneux, France
Search for other papers by Marie-Laure Raffin-Sanson in
Google Scholar
PubMed
EA 4340, Université Versailles Saint Quentin en Yvelines, UFR Simone Veil Santé, Montigny le Bretonneux, France
Search for other papers by Marie-Laure Raffin-Sanson in
Google Scholar
PubMed
Laure Cazabat
Laure Cazabat
Department of Endocrinology and Nutrition, Ambroise Paré Universitary Hospital, Assistance Publique Hôpitaux de Paris, Boulogne, France
EA 4340, Université Versailles Saint Quentin en Yvelines, UFR Simone Veil Santé, Montigny le Bretonneux, France
Search for other papers by Laure Cazabat in
Google Scholar
PubMed
EA 4340, Université Versailles Saint Quentin en Yvelines, UFR Simone Veil Santé, Montigny le Bretonneux, France
Search for other papers by Laure Cazabat in
Google Scholar
PubMed
chemically intact TH [ 1 ]. The majority of these patients carry a mutation in the β isoform of the thyroid hormone receptor gene ( THRB ), which has an autosomal dominant transmission, a situation defined in the new nomenclature as resistance to thyroid
Giorgio Radetti
Giorgio Radetti
Marienklinik, Bolzano, Italy
Search for other papers by Giorgio Radetti in
Google Scholar
PubMed
Search for other papers by Giorgio Radetti in
Google Scholar
PubMed
Franco Rigon
Franco Rigon
Department of Paediatrics, University of Padua, Padua, Italy
Search for other papers by Franco Rigon in
Google Scholar
PubMed
Search for other papers by Franco Rigon in
Google Scholar
PubMed
Alessandro Salvatoni
Alessandro Salvatoni
Department of Medicine and Surgery, University of Insubria, Varese, Italy
Search for other papers by Alessandro Salvatoni in
Google Scholar
PubMed
Search for other papers by Alessandro Salvatoni in
Google Scholar
PubMed
Irene Campi
Irene Campi
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Search for other papers by Irene Campi in
Google Scholar
PubMed
Search for other papers by Irene Campi in
Google Scholar
PubMed
Tiziana De Filippis
Tiziana De Filippis
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Search for other papers by Tiziana De Filippis in
Google Scholar
PubMed
Search for other papers by Tiziana De Filippis in
Google Scholar
PubMed
Valentina Cirello
Valentina Cirello
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Search for other papers by Valentina Cirello in
Google Scholar
PubMed
Search for other papers by Valentina Cirello in
Google Scholar
PubMed
Silvia Longhi
Silvia Longhi
Department of Paediatrics, Regional Hospital of Bolzano, Bolzano, Italy
Search for other papers by Silvia Longhi in
Google Scholar
PubMed
Search for other papers by Silvia Longhi in
Google Scholar
PubMed
Fabiana Guizzardi
Fabiana Guizzardi
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Search for other papers by Fabiana Guizzardi in
Google Scholar
PubMed
Search for other papers by Fabiana Guizzardi in
Google Scholar
PubMed
Marco Bonomi
Marco Bonomi
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Marco Bonomi in
Google Scholar
PubMed
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Marco Bonomi in
Google Scholar
PubMed
Luca Persani
Luca Persani
Division of Endocrine and Metabolic Diseases and Laboratory of Endocrine and Metabolic Research, Istituto Auxologico Italiano, IRCCS, Milan, Italy
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
eutopic thyroid gland ( 1 ). The concomitant occurrence of CH and resistance to thyroid hormone syndrome type β (RTHβ) are exceptional, since only five patients have been described so far, and only in four patients, a mutation in the THRB gene has been
Samuel Refetoff
Samuel Refetoff
Departments of Medicine, The University of Chicago, Chicago, Ill., USA
Departments of Pediatrics, The University of Chicago, Chicago, Ill., USA
Genetics, The University of Chicago, Chicago, Ill., USA
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
Departments of Pediatrics, The University of Chicago, Chicago, Ill., USA
Genetics, The University of Chicago, Chicago, Ill., USA
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
J.H. Duncan Bassett
J.H. Duncan Bassett
Department of Medicine, Imperial College London, London, UK
Search for other papers by J.H. Duncan Bassett in
Google Scholar
PubMed
Search for other papers by J.H. Duncan Bassett in
Google Scholar
PubMed
Paolo Beck-Peccoz
Paolo Beck-Peccoz
Department of Clinical Sciences and Community Health, University of Milan
Fondazione Ca' Granda Policlinico, Milan, Italy
Search for other papers by Paolo Beck-Peccoz in
Google Scholar
PubMed
Fondazione Ca' Granda Policlinico, Milan, Italy
Search for other papers by Paolo Beck-Peccoz in
Google Scholar
PubMed
Juan Bernal
Juan Bernal
Instituto de Investigaciones Biomédicas, Consejo Superior de Investigaciones Científicas-Universidad Autonoma de Madrid and Centro de Investigación Biomédica en Red de Enfermedades Raras, Madrid, Spain
Search for other papers by Juan Bernal in
Google Scholar
PubMed
Search for other papers by Juan Bernal in
Google Scholar
PubMed
Gregory Brent
Gregory Brent
Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, Calif., USA
Search for other papers by Gregory Brent in
Google Scholar
PubMed
Search for other papers by Gregory Brent in
Google Scholar
PubMed
Krishna Chatterjee
Krishna Chatterjee
Wellcome-Medical Research Council Institute of Metabolic Science, University of Cambridge, Cambridge, UK
Search for other papers by Krishna Chatterjee in
Google Scholar
PubMed
Search for other papers by Krishna Chatterjee in
Google Scholar
PubMed
Leslie J. De Groot
Leslie J. De Groot
Thyroidmanager and Endotext, South Dartmouth, Mass
Search for other papers by Leslie J. De Groot in
Google Scholar
PubMed
Search for other papers by Leslie J. De Groot in
Google Scholar
PubMed
Alexandra M. Dumitrescu
Alexandra M. Dumitrescu
Departments of Medicine, The University of Chicago, Chicago, Ill., USA
Search for other papers by Alexandra M. Dumitrescu in
Google Scholar
PubMed
Search for other papers by Alexandra M. Dumitrescu in
Google Scholar
PubMed
J. Larry Jameson
J. Larry Jameson
Raymond and Ruth Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pa
Search for other papers by J. Larry Jameson in
Google Scholar
PubMed
Search for other papers by J. Larry Jameson in
Google Scholar
PubMed
Peter A. Kopp
Peter A. Kopp
Division of Endocrinology, Metabolism, and Molecular Medicine and Center for Genetic Medicine, Feinberg School of Medicine, Northwestern University, Chicago, Ill., USA
Search for other papers by Peter A. Kopp in
Google Scholar
PubMed
Search for other papers by Peter A. Kopp in
Google Scholar
PubMed
Yoshiharu Murata
Yoshiharu Murata
Research Institute of Environmental Medicine, Nagoya University, Nagoya, Japan
Search for other papers by Yoshiharu Murata in
Google Scholar
PubMed
Search for other papers by Yoshiharu Murata in
Google Scholar
PubMed
Luca Persani
Luca Persani
Department of Clinical Sciences and Community Health, University of Milan
Istituto Auxologico Italiano, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Istituto Auxologico Italiano, Milan, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Jacques Samarut
Jacques Samarut
Ecole Normale Supérieure de Lyon, Lyon, France
Search for other papers by Jacques Samarut in
Google Scholar
PubMed
Search for other papers by Jacques Samarut in
Google Scholar
PubMed
Roy E. Weiss
Roy E. Weiss
Departments of Medicine, The University of Chicago, Chicago, Ill., USA
Departments of Pediatrics, The University of Chicago, Chicago, Ill., USA
Search for other papers by Roy E. Weiss in
Google Scholar
PubMed
Departments of Pediatrics, The University of Chicago, Chicago, Ill., USA
Search for other papers by Roy E. Weiss in
Google Scholar
PubMed
Graham R. Williams
Graham R. Williams
Department of Medicine, Imperial College London, London, UK
Search for other papers by Graham R. Williams in
Google Scholar
PubMed
Search for other papers by Graham R. Williams in
Google Scholar
PubMed
Paul M. Yen
Paul M. Yen
Laboratory of Hormone Action, Singapore Institute of Clinical Sciences, Singapore, Singapore
Search for other papers by Paul M. Yen in
Google Scholar
PubMed
Search for other papers by Paul M. Yen in
Google Scholar
PubMed
Resistance to thyroid hormone (RTH) was first described in 1967 [ 1 ], and the first mutations in the THRB gene were identified in 1989 [ 2 , 3 ], only 3 years after the cloning of the THR genes [ 4 , 5 ]. The cardinal features of this
Yalan Hu
Yalan Hu
Department of Laboratory Medicine, Endocrine Laboratory, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Search for other papers by Yalan Hu in
Google Scholar
PubMed
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Search for other papers by Yalan Hu in
Google Scholar
PubMed
Kim Falize
Kim Falize
Department of Laboratory Medicine, Endocrine Laboratory, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Kim Falize in
Google Scholar
PubMed
Search for other papers by Kim Falize in
Google Scholar
PubMed
A S Paul van Trotsenburg
A S Paul van Trotsenburg
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Department of Pediatric Endocrinology, Emma Children’s Hospital, Amsterdam University Medical Center, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by A S Paul van Trotsenburg in
Google Scholar
PubMed
Department of Pediatric Endocrinology, Emma Children’s Hospital, Amsterdam University Medical Center, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by A S Paul van Trotsenburg in
Google Scholar
PubMed
Raoul Hennekam
Raoul Hennekam
Department of Pediatrics, Emma Children’s Hospital, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Raoul Hennekam in
Google Scholar
PubMed
Search for other papers by Raoul Hennekam in
Google Scholar
PubMed
Eric Fliers
Eric Fliers
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Department of Endocrinology, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Eric Fliers in
Google Scholar
PubMed
Department of Endocrinology, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Eric Fliers in
Google Scholar
PubMed
Eveline Bruinstroop
Eveline Bruinstroop
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Department of Endocrinology, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Eveline Bruinstroop in
Google Scholar
PubMed
Department of Endocrinology, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Search for other papers by Eveline Bruinstroop in
Google Scholar
PubMed
Anita Boelen
Anita Boelen
Department of Laboratory Medicine, Endocrine Laboratory, Amsterdam UMC, University of Amsterdam, Amsterdam, the Netherlands
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Search for other papers by Anita Boelen in
Google Scholar
PubMed
Amsterdam Gastroenterology, Endocrinology & Metabolism (AGEM) Research Institute, Amsterdam UMC, Amsterdam, the Netherlands
Search for other papers by Anita Boelen in
Google Scholar
PubMed
GATTTCCCAGGAAGACATAAACC 77 Thyroid hormone receptor alpha Thra CATCTTTGA ACTGGGCAA GT CTGAGGCTT TAGACTTCC TGATC 347 Thyroid hormone receptor beta1 Thrb1 CACCTGGAT CCTGACGAT GT ACAGGTGAT GCAGCGATA GT 167 Thyroid hormone receptor beta2
Luca Persani
Luca Persani
Department of Endocrine and Metabolic Diseases, IRCCS Istituto Auxologico Italiano, Milano, Italy
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milano, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milano, Italy
Search for other papers by Luca Persani in
Google Scholar
PubMed
Patrice Rodien
Patrice Rodien
Service d’Endocrinologie-Diabétologie-Nutrition, Centre de référence des maladies rares de la Thyroïde et des récepteurs hormonaux, CHU d’Angers, Angers, France.
Search for other papers by Patrice Rodien in
Google Scholar
PubMed
Search for other papers by Patrice Rodien in
Google Scholar
PubMed
Carla Moran
Carla Moran
Institute of Metabolic Science, University of Cambridge, Cambridge, UK
Endocrine Section, Beacon Hospital, Dublin, Ireland.
School of Medicine, University College Dublin, Ireland
Endocrinology Department, St Vincent’s University Hospital, Dublin, Ireland
Search for other papers by Carla Moran in
Google Scholar
PubMed
Endocrine Section, Beacon Hospital, Dublin, Ireland.
School of Medicine, University College Dublin, Ireland
Endocrinology Department, St Vincent’s University Hospital, Dublin, Ireland
Search for other papers by Carla Moran in
Google Scholar
PubMed
W Edward Visser
W Edward Visser
Department of Internal Medicine and Rotterdam Thyroid Center, Erasmus University Medical Center, Rotterdam, The Netherlands
Search for other papers by W Edward Visser in
Google Scholar
PubMed
Search for other papers by W Edward Visser in
Google Scholar
PubMed
Stefan Groeneweg
Stefan Groeneweg
Department of Internal Medicine and Rotterdam Thyroid Center, Erasmus University Medical Center, Rotterdam, The Netherlands
Search for other papers by Stefan Groeneweg in
Google Scholar
PubMed
Search for other papers by Stefan Groeneweg in
Google Scholar
PubMed
Robin Peeters
Robin Peeters
Department of Internal Medicine and Rotterdam Thyroid Center, Erasmus University Medical Center, Rotterdam, The Netherlands
Search for other papers by Robin Peeters in
Google Scholar
PubMed
Search for other papers by Robin Peeters in
Google Scholar
PubMed
Samuel Refetoff
Samuel Refetoff
Departments of Medicine and Paediatrics and Committee on Genetics, The University of Chicago, Chicago, Illinois, USA
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
Search for other papers by Samuel Refetoff in
Google Scholar
PubMed
Mark Gurnell
Mark Gurnell
Institute of Metabolic Science, University of Cambridge, Cambridge, UK
Search for other papers by Mark Gurnell in
Google Scholar
PubMed
Search for other papers by Mark Gurnell in
Google Scholar
PubMed
Paolo Beck-Peccoz
Paolo Beck-Peccoz
Department of Medical Biotechnology and Translational Medicine, University of Milan, Milano, Italy
Search for other papers by Paolo Beck-Peccoz in
Google Scholar
PubMed
Search for other papers by Paolo Beck-Peccoz in
Google Scholar
PubMed
Krishna Chatterjee
Krishna Chatterjee
Institute of Metabolic Science, University of Cambridge, Cambridge, UK
Search for other papers by Krishna Chatterjee in
Google Scholar
PubMed
Search for other papers by Krishna Chatterjee in
Google Scholar
PubMed
). If RTHβ is suspected, we recommend measuring TFTs in first-degree relatives. Finding abnormal TFTs in first-degree relatives strengthens the likelihood of RTHβ ( Recommendation: S; Quality of evidence: ØØ ØØ). We recommend THRB sequencing
