Abstract
Transducin β-like 1 X-linked receptor 1 (TBL1XR1) is a WD40 repeat-containing protein and part of the corepressor complex SMRT/NCoR that binds to the thyroid hormone receptor (TR). We recently described a mutation in TBL1XR1 in patients with Pierpont syndrome. A mouse model bearing this Tbl1xr1 mutation (Tbl1xr1Y446C/Y446C ) displays several aspects of the Pierpont phenotype. Although serum thyroid hormone (TH) concentrations were unremarkable in these mice, tissue TH action might be affected due to the role of TBL1XR1 in the SMRT/NCoR corepressor complex. The aim of the present study was to evaluate tissue TH metabolism and action in a variety of tissues of Tbl1xr1Y446C/Y446C mice. We studied the expression of genes involved in TH metabolism and action in tissues of naïve Tbl1xr1Y446C/Y446C mice and wild type (WT) mice. In addition, we measured deiodinase activity in liver (Dio1 and Dio3), kidney (Dio1 and Dio3) and BAT (Dio2). No striking differences were observed in the liver, hypothalamus, muscle and BAT between Tbl1xr1Y446C/Y446C and WT mice. Pituitary TRα1 mRNA expression was lower in Tbl1xr1Y446C/Y446C mice compared to WT, while the mRNA expression of Tshβ and the positively T3-regulated gene Nmb were significantly increased in mutant mice. Interestingly, Mct8 expression was markedly higher in WAT and kidney of mutants, resulting in (subtle) changes in T3-regulated gene expression in both WAT and kidney. In conclusion, mice harboring a mutation in TBL1XR1 display minor changes in cellular TH metabolism and action. TH transport via MCT8 might be affected as the expression is increased in WAT and kidney. The mechanisms involved need to be clarified.
Introduction
Transducin β-like 1 X-linked receptor 1 (TBL1XR1) is a WD40 repeat-containing protein and part of NCoR and SMRT corepressor complexes. These complexes interact with nuclear hormone receptors, a family of ligand-dependent transcription factors that play a central role in the regulation of gene transcription. We recently identified a mutation c.1337A>G; p.Y446C (rs878854402) in TBL1XR1 in six male patients with Pierpont syndrome, a condition characterized by a dysmorphic face, developmental delay, altered fat distribution and hearing loss but without hypothyroidism (1, 2, 3, 4). A mutation at the same position in the highly conserved WD40 domain of its close homolog transducin β-like 1X (TBL1X) was found in patients with the combination of hearing loss and isolated central congenital hypothyroidism (CH), a shortage of thyroid hormone (TH) that was already present at birth in affected individuals (5).
To understand the functional consequences of the mutation at the tissue level, we developed an animal model bearing the Tbl1xr1 Y446C mutation using CRISPR-Cas9 technology. The mice displayed delayed growth, changed body composition and impaired hearing (6). As in humans with Pierpont syndrome, also in the animal model, no differences in serum thyroxine (T4), triiodothyronine (T3) and thyroid-stimulating-hormone (TSH) concentrations were observed between Tbl1xr1Y446C/Y446C and wild type (WT) mice (6).
There were no serum TH abnormalities reported in Pierpont patients or Tbl1xr1Y446C/Y446C mice. However, circulating TH concentrations are not always consistent with tissue TH availability and action as, for example, seen in patients with resistance to thyroid hormone receptor-α (RTHα) (7). Two highly homologous thyroid hormone receptors (TRs) are known, i.e., TRα and TRβ, with a markedly different tissue distribution. Mutations in these homologous genes lead to markedly different phenotypes reflecting altered TH action in many tissues, but only mutations in TRβ lead to clearly abnormal serum TH concentrations (8). Both TBL1XR1 and TBL1X are being part of the NCoR/SMRT corepressor complex and have overlapping functions, it is reasonable to assume that a defective TBL1XR1 may have an effect on TH signaling via the affected SMRT/NCoR corepressor complex as observed in patients with mutations in TBL1X. Indeed, we observed changes in some T3-responsive genes in white adipose tissue of Tbl1xr1Y446C/Y446C mice compared to the WT (6).
We therefore aimed to get more insight into the functionality of TBL1XR1 and TBL1X in relation to T3-regulated gene expression hypothesizing that TBL1XR1 and TBL1X may differ in their preference for a specific TR. In the present study, we focus on the expression of genes involved in TH metabolism and regulation and on T3-responsive genes in both predominantly TRβ organs (liver, kidney, pituitary and hypothalamus) and TRα organs (muscle, white and brown adipose tissue) in WT mice having a mutation in TBL1XR1 (Tbl1xr1Y446C/Y446C).
Materials and methods
Generation of the Tbl1xr1Y446C/Y446C mice
Tbl1xr1Y446C/Y446C mice were generated using CRISPR-Cas9 technology as previously described (6). Mice at the age of 12 weeks were sacrificed by exsanguination. Hypothalamus, pituitary, liver, kidney, WAT, BAT and gastrocnemius muscle were collected and immediately frozen on dry ice and stored at −80℃ until further processing.
In vitro knockdown of TBL1XR1
The human hepatocellular carcinoma cell line HepG2 (ATCC) was cultured in Dulbecco's modified Eagle's medium (Gibco), supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% penicillin–streptomycin–neomycin (Sigma). The cells were cultured in the medium with low T3 concentrations (Dulbecco’s modified Eagle’s medium, 10% charcoal-stripped FBS and 1% penicillin–streptomycin–neomycin) for 3 days prior to the experiment reaching 80% confluence. Knockdown of TBL1XR1 was performed by introducing small interference RNA (siRNA) using Lipofectamine™ RNAiMAX (Invitrogen) according to the manufacturer’s protocol. After transfection, cells were incubated for 24 h at 37℃/5% CO2 until T3 administration. Three specific siRNAs of TBL1XR1 (siRNA1:IDs36171, siRNA2:IDs36172, siRNA3:IDs36173) and negative control siRNAs (scrambled siRNAs with matching GC content) (Ambion) were tested. Knockdown efficiency was determined by measuring Tbl1xr1 mRNA expression by qPCR. siRNA2 gave the best knockdown (61%) and was used for further studies. After 24 h of transfection, increasing concentrations T3 (Sigma; 0 nM, 0.1 nM, 1 nM, 10 nM and 100 nM) were added for 24 h. Subsequently, cells were harvested for RNA isolation. Three independent experiments were performed and each containing of a technical triplicate.
RNA isolation and qPCR
Total RNA from the hypothalamus, pituitary, liver, kidney, WAT, BAT and gastrocnemius muscle was isolated as previously described (6). Total RNA from HepG2 cells was isolated using the High Pure RNA isolation kit (Roche). RNA yield was determined using the Nanodrop (Nanodrop) and cDNA was synthesized with equal RNA input with the Transcriptor First Strand cDNA Synthesis Kit (Roche) for qPCR using oligo-d (T) primers (Roche Molecular Biochemicals). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included. Quantitative PCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline). Quantification was performed using the LinReg software. PCR efficiency was checked individually and samples with a deviation of more than 5% of the mean were excluded from the analysis. Calculated values were related to the geometric mean expression of the reference genes EEF1A1, TBP and HPRT, all showing stable expression under the experimental conditions. The primers used for qPCR are listed in Table 1.
List of primers used for qPCR.
| Gene name | Symbol | Forward (5′-3′) | Reverse (5′-3′) | Product length (bp) |
|---|---|---|---|---|
| Mouse | ||||
| Eukaryotic translation elongation factor 1 alpha 1 | Eef1a1 | AGTCGCCTTGGACGTTCTT | ATTTGTAGATCAGGTGGCCG | 174 |
| Ribosomal protein, large, P0 | Rplp0 | GGCCCTGCACTCTCGCTTTC | TGCCAGGACGCGCTTGT | 124 |
| Hypoxanthine guanine phosphoribosyl transferase | Hprt | GCAGTACAGCCCCAAAATGG | AACAAAGTCTGGCCTGTATCCAA | 84 |
| Deiodinase, iodothyronine, type I | Dio1 | GAGCAGCCAGCTCTACGC GG | TGGGGAGCC TTCCTGCTG GT | 186 |
| Deiodinase, iodothyronine, type II | Dio2 | GCTTCCTCC TAGATGCCT ACAA | CCGAGGCAT AATTGTTAC CTG | 105 |
| Deiodinase, iodothyronine type III | Dio3 | CCAACTCTAGCAGTTCCGCA | GCCTCCCTGGTACATGATGG | 83 |
| Solute carrier family 16 (monocarboxylic acid transporters), member 2 | Slc16a2 (Mct8) | GTGCTCTTGGTGTGCATTGG | GGGACACCCGCAAAGTAGAA | 386 |
| Solute carrier family 16 (monocarboxylic acid transporters), member 10 | Slc16a10 (Mct10) | TGATTCCCCTGTGCAGCGCC | CCACGTCGTAGGTGCCCAGC | 228 |
| Solute carrier organic anion transporter family, member 1c1 | Slco1c1 | ATCACAGAACAAAATAAGTCACGAA | GATTTCCCAGGAAGACATAAACC | 77 |
| Thyroid hormone receptor alpha | Thra | CATCTTTGA ACTGGGCAA GT | CTGAGGCTT TAGACTTCC TGATC | 347 |
| Thyroid hormone receptor beta1 | Thrb1 | CACCTGGAT CCTGACGAT GT | ACAGGTGAT GCAGCGATA GT | 167 |
| Thyroid hormone receptor beta2 | Thrb2 | GTGAATCAG CCTTATACC TG | ACAGGTGAT GCAGCGATA GT | 255 |
| Thyroid-stimulating hormone receptor | Tshr | GCTCATTCT GCTAACCAG CC | GCGAAAACA GTGAAGAAG CC | 204 |
| Thyrotropin-releasing hormone receptor | Trhr | CAACAGATGCTTCAACAGCAC | TTACAACCACTGCGAGCATC | 68 |
| Thyroid-stimulating hormone beta subunit | Tshb | TCAACACCA CCATCTGTG CT | TTGCCACAC TTGCAGCTT AC | 196 |
| TRH-degrading enzyme | Trhde | TGGCCTTGAACACAACTGGT | GCGCAAAACTGCCATCTCAA | 131 |
| Neuromedin B | Nmb | CTTCGCATTGTTCGCTTCCG | CTAGAGCTTTCTTTCGCAGGAG | 248 |
| Kruppel-like factor 9 | Klf9 | CCACCGAATCTGGGTCGAG | TCCGAGCGCGAGAACTTTT | 265 |
| ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 | Serca1 | GGAATGCAGAGAACGCTATCG | TCCTTTGCACTGACTTTCGGT | 90 |
| ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | Serca2a | AATCTGACCCAGTGGCTGATG | AGAGGGCTGGTAGATGTGTTG | 197 |
| Myosin, heavy polypeptide 1, skeletal muscle, adult | Myh1 | CGGAGTCAGGTGAATACTCACG | GAGCATGAGCTAAGGCACTCT | 153 |
| Myosin, heavy polypeptide 2, skeletal muscle, adult | Myh2 | TGGAGGGTGAGGTAGAGAGTG | TTGGATAGATTTGTGTTGGATTG | 220 |
| Myosin, heavy polypeptide 4, skeletal muscle | Myh4 | CACCTGGACGATGCTCTCAGA | GCTCTTGCTCGGCCACTCT | 150 |
| Myosin, heavy polypeptide 7, cardiac muscle, beta | Myh7 | ACTGTCAACACTAAGAGGGTCA | TTGGATGATTTGATCTTCCAGGG | 114 |
| Myogenin | Myog | TTGCTCAGCTCCCTCAACCAGGA | TGCAGATTGTGGGCGTCTGTAGG | 193 |
| Lysine demethylase and nuclear receptor corepressor | Hr | CGGAGACAATCATAGGAAGCAAG | CCGGTCAGTACCCCTACCT | 184 |
| Glycoprotein hormones, alpha subunit | Cga | GATCGACAATCACCTGCCCA | GTTTACATTCTGGGCAACCCTG | 178 |
| Phosphoenolpyruvate carboxykinase 1, cytosolic | Pck1 | ATGTTCGGGCGGATTGAAG | TCAGGTTCAAGGCGTTTTCC | 81 |
| Thyroid hormone responsive | Thrsp | CATCCTTACCCACCTGACCC | TGTCCAGGTCTCGGGTTGAT | 157 |
| Carnitine palmitoyltransferase 1a, liver | Cpt1a | AAA GAT CAA TCG GAC CCT AGA CA | CAG CGA GTA GCG CAT AGT CA | 123 |
| Glucose-6-phosphatase, catalytic | G6pc | TCA ACC TCG TCT TCA AGT GGA TT | TGT AGT AGT CGG TGT CCA GGA CC | 71 |
| Human | ||||
| TBL1X/Y related 1 | TBL1XR1 | CCATGGCCAGTCCACTACAG | TCCAGCACTTGGTGAACAGA | 126 |
| Hypoxanthine phosphoribosyltransferase 1 | HPRT | CCTGCTGGATTACATCAAAGCACTG | TCCAACACTTCGTGGGGTCCT | 289 |
| Eukaryotic translation elongation factor 1 alpha 1 | EEF1A1 | TTTTCGCAACGGGTTTGCC | TTGCCCGAATCTACGTGTCC | 120 |
| TATA-box binding protein | TBP | CCCGAAACGCCGAATATAATCC | AATCAGTGCCGTGGTTCGTG | 80 |
| KLF transcription factor 9 | KLF9 | CCTCCCATCTCAAAGCCCATT | CGCCTTTTTCGATCGCTTGAT | 248 |
| Iodothyronine deiodinase 1 | DIO1 | TGGTTCGTCTTGAAGGTCCG | AAATTCAGCACCAGTGGCCT | 149 |
| Thyroid hormone responsive | THRSP | CGAGAAAGCCCAGGAGGTGA | AGCATCCCGGAGAACTGAGC | 204 |
| Carnitine palmitoyltransferase 1A | CPT1A | TGTGCTGGATGGTGTCTGTCTC | CGTCTTTTGGGATCCACGATT | 100 |
| Glucose-6-phosphatase catalytic subunit 1 | G6PC1 | GACTGGCTCAACCTCGTCTT | CGTAGTATACACCTGCTGTGCC | 181 |
| Phosphoenolpyruvate carboxykinase 1 | PCK1 | GCTGGTGTCCCTCTAGTCTATG | GGTATTTGCCGAAGTTGTAG | 166 |
Deiodinase activity
The deiodinase activity was measured as previously described (3, 9, 10, 11). Briefly, tissue (BAT, liver and kidney) was homogenized on ice in PED50 buffer (0.1 M sodium phosphate, 2 mM EDTA pH 7.2, 50 mM dithiothreitol (DTT)) using a Polytron (Kinematica, Luzern, Switzerland) and directly used for analysis (BAT) or snap-frozen and stored at −80℃ until use. Protein concentration was measured with the Bio-Rad protein assay using bovine serum albumin (BSA) as the standard following the manufacturer’s instructions (Bio-Rad Laboratories).
Liver and kidney D1 activity was measured using homogenate incubated for 30 min at 37℃ with 0.1 μM rT3 and approximately 1 × 105 cpm (3,3′,5′-125I) rT3 in PED10 (0.1 M sodium phosphate, 2 mM EDTA pH 7.2, 10 mM DTT). One sample of each group was incubated in the presence of 500 μM PTU to inhibit D1 activity representing a tissue blank. Liver D3 activity was measured using homogenate incubated for 2 h at 37℃ with 1 nM T3 or 500 nM T3 and approximately 2 × 105 cpm (3,3ʹ,5-125I) T3 in PE buffer. For each group, we included one sample with 500 nM T3 to saturate D3 representing a tissue blank. After deiodinase and tissue-specific incubations, reactions were stopped by adding ice-cold ethanol. After centrifugation and addition of 0.02 M ammonium acetate (pH 4), the mixture was applied to 4.6 × 250 mm Symmetry C18 column connected to a Waters HPLC system (Model 600E pump, Model 717 WISP autosampler, Waters, Etten-Leur, The Netherlands). The activity in the eluate was measured online using a Radiomatic 150 TR flow scintillation analyzer (Perkin Elmer). D1 activity was calculated by subtracting the activity measured in the tissue blank from the activity measured without PTU and expressed as pmol 3,3ʹ T2 generated per minute per mg protein. D3 activity was calculated by subtracting the activity measured in the tissue blank from the activity with 1 nM T3 and expressed as fmol generated 3,3ʹ T2 per minute per mg tissue.
D2 activity was measured using fresh tissue homogenate incubated for 2 h at 37℃ in the presence of 0.25 M sucrose, 1 nM T4, and approximately 1.105 cpm 125I-T4 (in-house, single-labeled tracer according to Wiersinga et al. (12)) in phosphate-EDTA buffer (PE buffer, 0.1 M sodium phosphate, 2nM EDTA, pH 7.2). For each group, we included one sample with 0.5 µM T4 incubation to saturate D2 representing a tissue blank. The reaction was stopped by adding bovine serum and 20% trichloroacetic acid (TCA). After centrifugation, released 125I was counted in the supernatant using the 2470 Automatic γ Counter Wizard2 (Perkin-Elmer). The D2 activity measured with the incubation with 1 nM T4 minus the incubation with 500 nM T4 represents true D2 activity. D2 activity was expressed as 125I fmol released per minute per gram protein. The assay is based on the protocol previously described by Werneck-de-Castro et al. (13).
Statistics
Data are expressed as mean ± standard error of the mean (s.e.m.). Variations between Tbl1xr1 Y446C/Y446C and WT mice were evaluated by two-way analysis of variance (ANOVA) using GraphPad Prism 9.0 software with two grouping factors (sex and strain) followed by Tukey’s post hoc analysis. If the magnitude and order of the sex differences were similar in mutant and WT mice, we presented male and female results together. The PCR results from HepG2 data were normalized to the mean value of the control-transfected group without T3 stimulation (T3 0nM) per experiment. Data from three repeated experiments were combined and presented in the graph, each dot represents the average value of the technical replicate. The effects of knockdown and T3 administration were analyzed by two-way ANOVA using GraphPad Prism 9.0 software with two grouping factors (knockdown and T3 administration) followed by Tukey’s post hoc analysis. Statistical significance was defined at a level of P < 0.05.
Results
Thyroid hormone metabolism in TRα tissues
To investigate TH metabolism, we determined mRNA expression of Dio1, Dio2 and Dio3, Mct8, Mct10, and Thra1 and Thrb1 in the gastrocnemius muscle, BAT and WAT, all known as TRα tissues (Fig. 1). D2 activity was measured in BAT. No differences in expression levels of genes involved in TH metabolism were observed in the gastrocnemius of Tbl1xr1Y446C/Y446C mice compared to WT mice. In BAT, Dio2 mRNA expression was significantly decreased in Tbl1xr1Y446C/Y446C mice compared to WT mice, which agrees with the trend in D2 activity in Tbl1xr1Y446C/Y446C mice. We therefore measured Tshr mRNA expression in BAT which was also decreased in Tbl1xr1Y446C/Y446C mice compared to the WT mice. The expression of genes involved in TH metabolism in WAT was similar in Tbl1xr1Y446C/Y446C mice and WT mice, except for the expression of Mct8, which was markedly higher in WT mice.
Relative RNA expression of TH metabolism genes and deiodinase activity in TRα tissues (gastrocnemius muscle, BAT and WAT) in Tbl1xr1 Y446C/Y446C mice compared to age- and sex-matched Tbl1xr1+/+ mice. Relative RNA expression is measured by qPCR analysis. White bars indicate Tbl1xr1+/+ and black bars indicate Tbl1xr1 Y446C/Y446C mice. Four groups in total: male-WT, male mutant, female-WT, female-mutant. There were 6–8 animals per group. Combined data of male and female are shown (expect for Mct8) since there is no sex difference or the sex differences were similar in both mutant and WT mice. Data are expressed as mean ± s.e.m.; differences between the groups were analyzed using two-way ANOVA; *(P < 0.05), **(P < 0.01), ***(P < 0.001).
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
Thyroid hormone metabolism in TRβ tissues
To investigate TH metabolism in TRβ tissues, we determined mRNA expression of Dio1, Dio2 and Dio3, Mct8, Mct10, Slco1c1, and Thra1 and Thrb1 in the hypothalamus, pituitary, liver and kidney (Fig. 2). D1 activity was measured in the liver and kidney, and D3 activity in the liver. No differences in the expression of genes involved in TH metabolism were observed in the hypothalamus and the liver of Tbl1xr1Y446C/Y446C and WT mice. In line, liver D1 and D3 activity were similar.
Relative RNA expression of TH metabolism genes and deiodinase activity in TRβ tissues (hypothalamus, pituitary, liver and kidney) in Tbl1xr1Y446C/Y446C mice compared to age- and sex-matched Tbl1xr1+/+ mice. Relative RNA expression is measured by qPCR analysis. White bars indicate Tbl1xr1+/+ and black bars indicate Tbl1xr1Y446C/Y446C mice. Four groups in total: male-WT, male mutant, female-WT, female-mutant. There were 6–8 animals per group. Combined data of male and female are shown since there is no sex difference or the sex differences were similar in both mutant and WT mice. Data are expressed as mean ± s.e.m.; differences between the groups were analyzed using two-way ANOVA; *(P < 0.05), **(P < 0.01).
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
In the pituitary, Thra1 expression was significantly lower in Tbl1xr1Y446C/Y446C mice compared to WT mice, while Trhr expression was higher. No differences in Dio1, Thrb1,Mct10 expression were observed in the kidneys of Tbl1xr1Y446C/Y446C and WT mice, while Mct8 expression was markedly higher in the kidney of Tbl1xr1Y446C/Y446C mice.
Thyroid-hormone-responsive gene expression in TRα tissues
Thyroid hormone action in the gastrocnemius was assessed by measuring mRNA expression of the following TH-responsive genes: Klf9, Serca1, Serca2a, Myh1, Myh2, Myh4, Myh7 and Myog (Fig. 3). No differences in mRNA expression were observed between Tbl1xr1Y446C/Y446C and WT mice, except for Serca1 which was slightly higher in the gastrocnemius of Tbl1xr1Y446C/Y446C mice. The TH action was assessed in BAT and WAT by measuring mRNA expression of Klf9. This was higher in WAT of Tbl1xr1Y446C/Y446C mice compared to WT mice, while no difference was observed in BAT.
Relative RNA expression of TH-responsive genes in TRα tissues (gastrocnemius muscle, BAT and WAT) in Tbl1xr1Y446C/Y446Cmice compared to age- and sex-matched Tbl1xr1+/+ mice. Relative RNA expression is measured by qPCR analysis. White bars indicate Tbl1xr1+/+ and black bars indicate Tbl1xr1Y446C/Y446C mice. Four groups in total: male-WT, male mutant, female-WT, female-mutant. There were 6–8 animals per group. Combined data of male and female are shown since there is no sex difference or the sex differences were similar in both mutant and WT mice. Data are expressed as mean ± s.e.m.; differences between the groups were analyzed using two-way ANOVA; *(P < 0.05), **(P < 0.01), ***(P < 0.001).
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
Thyroid-hormone-responsive genes in TRβ tissues
TH action in the hypothalamus was assessed by measuring mRNA expression of the TH-responsive gene Hairless (Hr) which was not changed in Tbl1xr1Y446C/Y446C mice compared to WT mice. TH action in the pituitary was assessed by measuring mRNA expression of the negatively T3-regulated genes Tshb and Cga and the positively T3-regulated gene Nmb. Pituitary Tshb and Nmb expression was higher in Tbl1xr1Y446C/Y446C mice than in WT mice (Fig. 4).
Relative RNA expression of TH-responsive genes in TRβ tissues (hypothalamus, pituitary, liver and kidney) in Tbl1xr1Y446C/Y446C mice compared to age- and sex-matched Tbl1xr1+/+ mice. Relative RNA expression is measured by qPCR analysis. White bars indicate Tbl1xr1+/+ and black bars indicate Tbl1xr1Y446C/Y446Cmice. Four groups in total: male-WT, male mutant, female-WT, female-mutant. There were 6–8 animals per group. Combined data of male and female are shown since there is no sex difference or the sex differences were similar in both mutant and WT mice. Data are expressed as mean ± s.e.m.; differences between the groups were analyzed using two-way ANOVA; *(P < 0.05), **(P < 0.01), ***(P < 0.001).
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
In the liver and kidney, TH action was assessed by measuring mRNA expression of the following TH-responsive genes Klf9, Thrsp, G6pc, Cpt1a and Pck1 (liver Pck1 data is published in (6)). No differences in mRNA expression were observed in the liver while Pck1 mRNA expression in the kidney was higher in Tbl1xr1Y446C/Y446C mice compared to WT mice (Fig. 4).
Sex difference of thyroid hormone metabolism gene and responsive genes
Sex-specific differences in thyroid homeostasis can occur (14, 15, 16), which is confirmed in the present study (Table 2). Sex differences were observed in Mct8 expression in the kidney and liver, Mct10 expression in the kidney, liver and gastrocnemius and Oatp1c1 expression in the hypothalamus. Deiodinase expression differed between male and female mice in the kidney (Dio1), WAT (Dio2) and liver Dio3. TR expression also differed between males and females: TRα1 in the hypothalamus and liver, TRβ1 in BAT and TRβ2 in the pituitary. As a result, sex differences were also observed in some TH-responsive genes in the tested organs: Myog in the gastrocnemius, Cpt1a in the liver and kidney, and Klf9, Thrsp and Pck1 in the kidney (Table 3). However, the magnitude and order of the sex differences were similar in mutant and WT mice.
Differences in mRNA expression of genes involved in the TH metabolism genes in TRα and TRβ tissues of Tbl1xr1Y446C/Y446C (mutant) and WT mice analyzed by two-way ANOVA. Symbols indicate difference between groups.
| Tissue | Gene | Genotype difference | Sex difference | Interaction | WT vs mutant male | WT vs mutant female | Male vs female WT | Male vs female mutant |
|---|---|---|---|---|---|---|---|---|
| Gastrocnemius | Dio2 | ns | ns | ** | ns | ns | ns | ns |
| Dio3 | ns | ns | ns | – | – | – | – | |
| Mct8 | ns | ns | ns | – | – | – | – | |
| Mct10 | ns | ** | ns | ns | ns | ns | * | |
| Thra1 | ns | ns | ns | – | – | – | – | |
| Thrb1 | ns | ns | ns | – | – | – | – | |
| BAT | Dio2 | * | ns | ns | ns | ns | ns | ns |
| Dio3 | ns | ns | ns | – | – | – | – | |
| Mct8 | ns | ns | ns | – | – | – | – | |
| Mct10 | ns | ns | * | ns | ns | ns | ns | |
| Thra1 | ns | ns | ns | – | – | – | – | |
| Thrb | ns | * | ns | ns | ns | ns | ns | |
| Tshr | * | ns | ns | ns | ns | ns | ns | |
| WAT | Dio2 | ns | * | ns | ns | ns | ns | ns |
| Dio3 | ns | ns | ns | – | – | – | – | |
| Mct8 | *** | * | * | *** | ns | ns | * | |
| Mct10 | ns | ns | ns | – | – | – | – | |
| Thra1 | ns | ns | ns | – | – | – | – | |
| Thrb1 | ns | ns | ns | – | – | – | – | |
| Tissue | Gene | Genotype difference | Sex difference | Interaction | WT vs mutant male | WT vs mutant female | Male vs female WT | Male vs female mutant |
| Pituitary | Dio1 | ns | ns | ns | – | – | – | – |
| Dio2 | ns | ns | ns | – | – | – | – | |
| Mct8 | ns | ns | ns | – | – | – | – | |
| Thra1 | * | ns | ns | ns | ns | ns | ns | |
| Thrb2 | ns | ** | ns | ns | ns | * | ns | |
| Trhr | ** | ns | ns | ns | ns | ns | ns | |
| Trhde | ns | ns | ns | – | – | – | – | |
| Hypothalamus | Dio2 | ns | ns | ns | – | – | – | – |
| Dio3 | ns | ns | ns | – | – | – | – | |
| Mct8 | ns | ns | ns | – | – | – | – | |
| Slco1c1 | ns | ** | ns | ns | ns | ns | * | |
| Thra1 | ns | * | ns | ns | ns | ns | ns | |
| Thrb2 | ns | ns | * | ns | ns | ns | ns | |
| Kidney | Dio1 | ns | *** | ns | ns | ns | *** | *** |
| Mct8 | * | * | ns | ns | ns | ns | ns | |
| Mct10 | ns | *** | ns | ns | ns | ns | * | |
| Thrb1 | ns | ns | ns | – | – | – | – | |
| Liver | Dio1 | ns | ns | ns | – | – | – | – |
| Dio3 | ns | *** | ns | ns | ns | *** | *** | |
| Mct8 | ns | *** | ns | ns | ns | ** | ** | |
| Mct10 | ns | ** | ns | ns | ns | ns | * | |
| Thra1 | ns | * | ns | ns | ns | ns | ns | |
| Thrb1 | ns | ns | ns | – | – | – | – |
*P < 0.05; **P < 0.01; ***P < 0.001.
Differences in mRNA expression of thyroid-hormone-responsive genes in TRα and TRβ tissues of Tbl1xr1Y446C/Y446C (mutant) and WT mice analyzed by two-way ANOVA. Symbols indicate difference between groups
| Tissue | Gene | Genotype difference | Sex difference | Interaction | WT vs mutant male | WT vs mutant female | Male vs female WT | Male vs female mutant |
|---|---|---|---|---|---|---|---|---|
| Gastrocnemius | Klf9 | ns | ns | ns | – | – | – | – |
| Serca1 | * | ns | ns | ns | ns | ns | ns | |
| Serca2a | ns | ns | ns | – | – | – | – | |
| Myh1 | ns | ns | ns | – | – | – | – | |
| Myh2 | ns | ns | ns | – | – | – | – | |
| Myh4 | ns | ns | ns | – | – | – | – | |
| Myh7 | ns | ns | ns | – | – | – | – | |
| Myog | ns | *** | ns | ns | ns | ns | ** | |
| BAT | Klf9 | ns | ns | ns | – | – | – | – |
| WAT | Klf9 | * | ns | ns | * | ns | ns | ns |
| Tissue | Gene | Genotype difference | Sex difference | Interaction | WT vs. mutant male | WT vs. mutant female | Male vs. female WT | Male vs. female mutant |
| Pituitary | Cga | ns | ns | ns | – | – | – | – |
| Tshb | ** | ns | ns | ns | * | ns | ns | |
| Nmb | ** | ns | ns | ns | ns | ns | ns | |
| Hypothalamus | Hr | ns | ns | ns | – | – | – | – |
| Kidney | Klf9 | ns | ** | ns | ns | ns | ns | ns |
| Cpt1a | ns | *** | ns | ns | ns | ns | ns | |
| G6pc | ns | ns | ns | – | – | – | – | |
| Thrsp | ns | * | ns | ns | ns | ns | ns | |
| Pck1 | * | ** | ns | ns | * | ns | ** | |
| Liver | Klf9 | ns | ns | ns | – | – | – | – |
| Thrsp | ns | ns | ns | – | – | – | – | |
| G6pc | ns | ns | ns | – | – | – | – | |
| Cpt1a | ns | * | ns | ns | ns | ns | ns |
*P < 0.05; **P < 0.01; ***P < 0.001.
Effect of TBL1XR1 knockdown on T3-regulated gene expression in HepG2 cells
To evaluate the effect of TBL1X knockdown on T3-regulated gene expression in HepG2 cells, mRNA expression of DIO1, KLF9, THRSP, CPT1A, G6PC and PCK1 was measured (Fig. 5). All genes were responsive to T3. The T3-induced increase in DIO1, THRSP,G6PC and PCK1 expression was impaired by knocking down TBL1XR1 of which DIO1 mRNA expression was severely affected (P kd < 0.0001). Knockdown of TBL1XR1 did not affect KLF9 and THRSP mRNA expression upon T3 stimulation.
Effects of TBL1XR1 knockdown on T3-regulated gene expression in HepG2 cells. The control situation is represented by the black dots and the TBL1XR1 knockdown is represented by white dots. Cells are stimulated with increasing concentrations of T3. Relative mRNA expression of the genes is normalized to the control group without T3 which is set at 1. Mean values ± s.e.m. of three independent experiments (THRSP only two experiments) are shown, each group of each experiment consists a technical triplicate. P-values represent the effect of T3 treatment and TBL1XR1 knockdown analyzed using two-way ANOVA; differences between the groups at a specific T3 concentration were given by symbols: *(P < 0.05), **(P < 0.01), ***(P < 0.001).
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
Discussion
The present study aimed to evaluate tissue TH metabolism and TH target gene expression in predominantly TRα organs (muscle, WAT and BAT) and TRβ organs (liver, kidney, pituitary and hypothalamus) of mice harboring a mutation in Tbl1xr1, a gene encoding a WD40 repeat-containing protein. TBL1XR1 is part of the SMRT/NCoR corepressor complex that binds to nuclear receptors and controls gene transcription. Previous work performed on two patient cohorts (Pierpont syndrome and isolated central CH with impaired hearing) unraveled two identical mutations in the two close homologs TBL1XR1 and TBL1X (4, 5). TBL1X is also part of NCoR and SMRT corepressor complexes and is involved in TH signaling. Despite the fact that TBL1XR1 is part of the same corepressor complex, hypothyroidism was not reported in Pierpont patients, and the mice harboring the Tbl1xr1 mutation did not show any abnormalities in serum TH concentrations. The striking differences in the clinical phenotypes of central CH and Pierpont patients are difficult to reconcile with overlapping functions of nearly identical proteins and suggests a differentiation in the interaction with other proteins in the corepressor complex. An attractive candidate for this is the TR. Three bonafide (T3 binding) TR isoforms can be distinguished, the TRα1, TRβ1 and TRβ2, with a clearly differential tissue distribution. Mutations in these genes are known to lead to different phenotypes reflecting altered TH action in many tissues, whereas only mutations in TRβ lead to clearly abnormal serum thyroid hormone concentrations, reflecting the important role of selective TRβ2 expression in the hypothalamus and anterior pituitary in negative feedback regulation (17). Although Thra1 expression in the hypothalamus and pituitary is substantial, we consider both organs as typically TRβ because of the abovementioned reason.
Recently, we have reported a homozygous mouse model of Pierpont syndrome, carrying the Y446C point mutation. These mice display several phenotypical characteristics of Pierpont syndrome including delayed growth and impaired hearing (6), while serum TH concentrations were unaffected. We decided to extend our observations in these mice by studying TH metabolism and action in selected TRα and TRβ organs in order to unravel the potential role of TBL1XR1. Ideally, one would also perform the same set of experiments in mice harboring the identical mutation in TBL1X but unfortunately, the generation of such a model using CRISPR-Cas9 technology failed (Y Hu, G Codner, M Stewart, SE Fleur, P van Trotsenburg, E Fliers, RC Hennekam & A Boelen, unpublished data).
Overall, no striking differences in genes involved in the TH metabolism were observed in TRα and TRβ organs of Tbl1xr1Y446C/Y446C mice compared to WT mice suggesting that TBL1XR1 is not involved in the basal regulation of Dio1 and Dio3. Interestingly, T3-induced DIO1 mRNA expression in HepG2 cells (human cell line) was markedly impaired if TBL1XR1 was knocked down suggesting a role for TBL1RX1 in the activation of DIO1. Dio2 expression was lower in BAT of mutant mice just as the expression of Tshr. It is known that the TSHR in BAT is involved in the regulation of thermogenesis by increasing uncoupling protein-1 (Ucp1) which is also responsive to T3 (18). However, mRNA expression of Mct8 and Mct10 and Thra1 in BAT did not differ in Tbl1xr1Y446C/Y446C mice, and Klf9 remained stable. Previously, we have shown that a variety of T3-responsive genes involved in fat and glucose metabolism (Thrsp, Fasn, Ucp1, Me, Glut4, Ppargc1a, Pck1) were unaltered in BAT of mutant mice (6). Together, these observations suggest that local TH activity in BAT is not affected by TBL1XR1 in spite of decreased Dio2 and Tshr expression.
Mct8 mRNA expression was higher in WAT and kidney of Tbl1xr1Y446C/Y446C mice, suggesting a role of TBL1XR1 in the regulation of kidney MCT8. MCT8 is an important TH transporter and is differentially expressed in cell types. Elevated MCT8 expression was found in human placenta associated with severe intrauterine growth restriction (associated with fetal hypothyroxinaemia), in femurs of hypothyroid mice, and in liver and skeletal muscle of critically ill patients (low-circulating TH concentrations) and rabbits (19, 20, 21). However, it is difficult to say that TH status is a modulator of MCT8, as liver Mct8 mRNA expression in mice was not affected by acute or chronic T3 administration (22). Furthermore, MCT8 protein expression was undetectable in the hypothalamus of a hyperthyroid subject (23) and athyroid Pax8 knockout mice showed unaffected Mct8 expression in the brain (24). Therefore, other mechanisms regulating MCT8 remain to be elucidated. The increase in Mct8 expression in WAT was associated with increased expression of Klf9 compared to WT mice. Previously, we showed that the mRNA expression of several other T3-responsive genes (Pparα, Ucp1, Fasn) was also significantly increased in WAT of mutant mice (6). Our experimental setup does not allow to discriminate between the possibility that TBL1XR1 is involved in the regulation of MCT8, thereby increasing intracellular T3 availability and T3-regulated gene expression or, alternatively, that TBL1XR1 is involved in T3-regulated gene expression by itself, possibly via the TRα in WAT. Either way, a WAT phenotype is present in Pierpont patients (4) and in the mouse model (6), which supports the role of TBL1XR1 in adipose tissue. The molecular mechanism involved remains to be established.
The increase in Mct8 in the kidney was associated with increased expression of Pck1 (a T3-responsive gene), while other T3-regulated genes were not affected in the kidney of mutant mice. Increased Mct8 and T3-responsive gene expression has been observed in both WAT and kidney, while WAT is a TRα organ (25) and the kidney predominantly expresses TRβ1 (8).
In contrast to WAT and BAT, Dio2, Dio3, Thra1, Mct8 and Mct10 expression did not differ in the gastrocnemius of mice harboring the TBL1XR1 mutation. Also, most of the T3-responsive genes (Klf9, Serca2a, Myh1, Myh2, Myh4,Myog and Myh7) studied were similar in mutant and WT mice. Only Serca1 mRNA expression was higher in gastrocnemius of Tbl1xr1Y446C/Y446C mice. As none of the other T3-responsive genes were affected it might be possible that TBL1XR1 has an effect on Serca1 via other nuclear receptors.
In contrast to other TRβ organs, the pituitary of mutant mice displayed significant changes in the expression of T3-regulated genes while Dio1 and Dio2 and Mct8 did not differ. Tshb is negatively regulated by T3 (17) and was found to be increased in the pituitary of mutant mice, while the expression of Nmb, a positively regulated gene (26), also increased. These changes are difficult to reconcile with altered TH action. Pituitary Trhr expression was significantly increased in Tbl1xr1Y446C/Y446C mice, the expression of which is regulated among others by thyrotropin-releasing hormone (TRH). However, using in situ hybridization, we showed earlier that TRH expression is unaltered in the paraventricular nucleus of the mutant mice (6).
We observed the changes of a variety of T3-responsive genes in the tissues of Tbl1xr1Y446C/Y446C mice. However, a limitation of our study is that these experiments were performed in the basal state and not after stimulation of T3. To further explore the effect of TBL1XR1 on T3 signaling, we knocked down TBL1XR1 in a human liver cell line (HepG2) and stimulated these cells with increasing concentrations of T3. Six well-known T3-responsive genes were evaluated and we showed that T3-induced mRNA expression of DIO1, THRSP, G6PC and PCK1 was significantly lower in TBL1XR1 knockdown cells compared to control cells. Although the molecular mechanism is still unknown, it is clear that TBL1XR1 is differentially involved in T3 signaling. Interestingly, TBL1XR1 knockdown resulted in impaired DIO1, THRSP, G6PC and PCK1 mRNA expression upon T3 stimulation which is in contrast to the expectation that a disturbed corepressor complex leads to T3 hypersensitivity as observed in mice lacking NCOR in the liver (27). Our results suggest that TBL1XR1 function as a coactivator instead as a corepressor. Indeed, TBL1XR1 is required for transcriptional activation by many nuclear receptors (28, 29).
In conclusion, in the present study we evaluated tissue TH metabolism and action in a variety of tissues of Tbl1xr1Y446C/Y446C mice (Fig. 6). We speculated that the differences in phenotypes between patients with Pierpont syndrome and isolated central CH based on mutations in TBL1XR1 and TBL1X, respectively, were related to the differential effects of these proteins on TRα and TRβ. However, our results do not allow for the conclusion that TBL1XR1, as part of the corepressor complex, preferably binds to the TRα. This is illustrated by the observation that in WAT of mutant mice, both Klf9 and Fasn expression were upregulated, as Klf9 is positively regulated by T3 via TRα1 (30), while Fasn is positively regulated by T3 via the TRβ1 (31). In addition, knockdown of TBL1XR1 in HepG2 cells resulted in impaired expression of DIO1, THRSP, G6PC and PCK1 mRNA expression upon increasing T3 concentrations, which suggests that TBL1XR1 may have an effect on T3 signaling via being a coactivator. Therefore, further studies are necessary to unravel the role of TBL1XR1 in T3 signaling.
Schematic overview of the effects of a corepressor complex that contains a mutated TBL1XR1 (mice study) or less TBL1XR1 (cells) on T3-regulated gene expression in the peripheral T3 target organs (brown fat, white adipose tissue, muscle, liver, kidney) and HepG2 cells.
Citation: European Thyroid Journal 12, 5; 10.1530/ETJ-23-0077
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
Chinese Scholarship Council (CSC) (201907720056 to Y H).
Author contribution statement
YH performed the analyses and wrote this paper. KF helped with the analyses and reviewed the paper before submission. ASPT and RH reviewed the paper before submission. EF and EB made substantial contributions to the content of the paper and reviewed the manuscript before submission. AB designed the study, made substantial contributions to the content, reviewed/edited the manuscript before submission and supervised.
Acknowledgements
We would like to thank Joelle Wiersema and Marja van Veen (Endocrine Laboratory) for expert help with deiodinase activity measurement.
References
- 1↑
Pierpont MEM, Stewart FJ, & Gorlin RJ. Plantar lipomatosis, unusual facial phenotype and developmental delay: a new MCA/MR syndrome. American Journal of Medical Genetics 1998 75 18–21. (https://doi.org/10.1002/(SICI)1096-8628(19980106)75:1<18::AID-AJMG5>3.0.CO;2-M)
- 2↑
Oudesluijs GG, Hordijk R, Boon M, Sijens PE, & Hennekam RC. Plantar lipomatosis, unusual facies, and developmental delay: confirmation of Pierpont syndrome. American Journal of Medical Genetics. Part A 2005 137 77–80. (https://doi.org/10.1002/ajmg.a.30863)
- 3↑
Peeters RP, Wouters PJ, Kaptein E, van Toor H, Visser TJ, & Van den Berghe G. Reduced activation and increased inactivation of thyroid hormone in tissues of critically ill patients. Journal of Clinical Endocrinology and Metabolism 2003 88 3202–3211. (https://doi.org/10.1210/jc.2002-022013)
- 4↑
Heinen CA, Jongejan A, Watson PJ, Redeker B, Boelen A, Boudzovitch-Surovtseva O, Forzano F, Hordijk R, Kelley R, Olney AH, et al.A specific mutation in TBL1XR1 causes Pierpont syndrome. Journal of Medical Genetics 2016 53 330–337. (https://doi.org/10.1136/jmedgenet-2015-103233)
- 5↑
Heinen CA, Losekoot M, Sun Y, Watson PJ, Fairall L, Joustra SD, Zwaveling-Soonawala N, Oostdijk W, van den Akker EL, Alders M, et al.Mutations in TBL1X are associated with central hypothyroidism. Journal of Clinical Endocrinology and Metabolism 2016 101 4564–4573. (https://doi.org/10.1210/jc.2016-2531)
- 6↑
Hu Y, Lauffer P, Stewart M, Codner G, Mayerl S, Heuer H, Ng L, Forrest D, van Trotsenburg P, Jongejan A, et al.An animal model for Pierpont syndrome: a mouse bearing the Tbl1xr1Y446C/Y446C mutation. Human Molecular Genetics 2022 31 2951–2963. (https://doi.org/10.1093/hmg/ddac086)
- 7↑
Moran C, & Chatterjee K. Resistance to thyroid hormone due to defective thyroid receptor alpha. Best Practice and Research. Clinical Endocrinology and Metabolism 2015 29 647–657. (https://doi.org/10.1016/j.beem.2015.07.007)
- 8↑
Ortiga-Carvalho TM, Sidhaye AR, & Wondisford FE. Thyroid hormone receptors and resistance to thyroid hormone disorders. Nature Reviews. Endocrinology 2014 10 582–591. (https://doi.org/10.1038/nrendo.2014.143)
- 9↑
Kwakkel J, Chassande O, van Beeren HC, Wiersinga WM, & Boelen A. Lacking thyroid hormone receptor beta gene does not influence alterations in peripheral thyroid hormone metabolism during acute illness. Journal of Endocrinology 2008 197 151–158. (https://doi.org/10.1677/JOE-07-0601)
- 10↑
Boelen A, van der Spek AH, Bloise F, de Vries EM, Surovtseva OV, van Beeren M, Ackermans MT, Kwakkel J, & Fliers E. Tissue thyroid hormone metabolism is differentially regulated during illness in mice. Journal of Endocrinology 2017 233 25–36. (https://doi.org/10.1530/JOE-16-0483)
- 11↑
van Beeren HC, Kwakkel J, Ackermans MT, Wiersinga WM, Fliers E, & Boelen A. Action of specific thyroid hormone receptor alpha(1) and beta(1) antagonists in the central and peripheral regulation of thyroid hormone metabolism in the rat. Thyroid 2012 22 1275–1282. (https://doi.org/10.1089/thy.2012.0135)
- 12↑
Wiersinga WM, & Chopra IJ. Radioimmunoassay of thyroxine (T4), 3,5,3’-triiodothyronine (T3), 3,3’,5’-triiodothyronine (reverse T3, rT3), and 3,3’-diiodothyronine (T2). Methods in Enzymology 1982 84 272–303. (https://doi.org/10.1016/0076-6879(8284024-x)
- 13↑
Werneck-de-Castro JP, Fonseca TL, Ignacio DL, Fernandes GW, Andrade-Feraud CM, Lartey LJ, Ribeiro MB, Ribeiro MO, Gereben B, & Bianco AC. Thyroid hormone signaling in male mouse skeletal muscle is largely independent of D2 in myocytes. Endocrinology 2015 156 3842–3852. (https://doi.org/10.1210/en.2015-1246)
- 14↑
Venugopalan V, Al-Hashimi A, Rehders M, Golchert J, Reinecke V, Homuth G, Volker U, Manirajah M, Touzani A, Weber J, et al.The thyroid hormone transporter Mct8 restricts cathepsin-mediated thyroglobulin processing in male mice through thyroid auto-regulatory mechanisms that encompass autophagy. International Journal of Molecular Sciences 2021 22. (https://doi.org/10.3390/ijms22010462)
- 15↑
Eugene D, Djemli A, & Van Vliet G. Sexual dimorphism of thyroid function in newborns with congenital hypothyroidism. Journal of Clinical Endocrinology and Metabolism 2005 90 2696–2700. (https://doi.org/10.1210/jc.2004-2320)
- 16↑
Van Vliet G, Larroque B, Bubuteishvili L, Supernant K, & Leger J. Association of Francaise pour le Depistage et la Prevention des Handicaps de lE. Sex-specific impact of congenital hypothyroidism due to thyroid dysgenesis on skeletal maturation in term newborns. Journal of Clinical Endocrinology and Metabolism 2003 88 2009–2013. (https://doi.org/10.1210/jc.2002-021735)
- 17↑
Bargi-Souza P, Goulart-Silva F, & Nunes MT. Novel aspects of T(3) actions on GH and TSH synthesis and secretion: physiological implications. Journal of Molecular Endocrinology 2017 59 R167–R178. (https://doi.org/10.1530/JME-17-0068)
- 18↑
Endo T, & Kobayashi T. Thyroid-stimulating hormone receptor in brown adipose tissue is involved in the regulation of thermogenesis. American Journal of Physiology. Endocrinology and Metabolism 2008 295 E514–E518. (https://doi.org/10.1152/ajpendo.90433.2008)
- 19↑
Chan SY, Franklyn JA, Pemberton HN, Bulmer JN, Visser TJ, McCabe CJ, & Kilby MD. Monocarboxylate transporter 8 expression in the human placenta: the effects of severe intrauterine growth restriction. Journal of Endocrinology 2006 189 465–471. (https://doi.org/10.1677/joe.1.06582)
- 20↑
Capelo LP, Beber EH, Fonseca TL, & Gouveia CH. The monocarboxylate transporter 8 and L-type amino acid transporters 1 and 2 are expressed in mouse skeletons and in osteoblastic MC3T3-E1 cells. Thyroid 2009 19 171–180. (https://doi.org/10.1089/thy.2008.0120)
- 21↑
Mebis L, Paletta D, Debaveye Y, Ellger B, Langouche L, D'Hoore A, Darras VM, Visser TJ, & Van den Berghe G. Expression of thyroid hormone transporters during critical illness. European Journal of Endocrinology 2009 161 243–250. (https://doi.org/10.1530/EJE-09-0290)
- 22↑
Ohba K, Sinha RA, Singh BK, Iannucci LF, Zhou J, Kovalik JP, Liao XH, Refetoff S, Sng JCG, Leow MK, et al.Changes in hepatic TRβ protein expression, lipogenic gene expression, and long-chain acylcarnitine levels during chronic hyperthyroidism and triiodothyronine withdrawal in a mouse model. Thyroid 2017 27 852–860. (https://doi.org/10.1089/thy.2016.0456)
- 23↑
Alkemade A, Friesema EC, Unmehopa UA, Fabriek BO, Kuiper GG, Leonard JL, Wiersinga WM, Swaab DF, Visser TJ, & Fliers E. Neuroanatomical pathways for thyroid hormone feedback in the human hypothalamus. Journal of Clinical Endocrinology and Metabolism 2005 90 4322–4334. (https://doi.org/10.1210/jc.2004-2567)
- 24↑
Heuer H, Maier MK, Iden S, Mittag J, Friesema EC, Visser TJ, & Bauer K. The monocarboxylate transporter 8 linked to human psychomotor retardation is highly expressed in thyroid hormone-sensitive neuron populations. Endocrinology 2005 146 1701–1706. (https://doi.org/10.1210/en.2004-1179)
- 25↑
Mullur R, Liu YY, & Brent GA. Thyroid hormone regulation of metabolism. Physiological Reviews 2014 94 355–382. (https://doi.org/10.1152/physrev.00030.2013)
- 26↑
Mazzocchi G, Spinazzi R, & Nussdorfer GG. Chapter 121 - Galanin, neurotensin, and neuromedins in the local regulation of endocrine glands. In Handbook of Biologically Active Peptides 883–888. Kastin AJ, Ed. Burlington, MA, USA: Academic Press 2006. (https://doi.org/10.1016/B978-012369442-3/50124-0)
- 27↑
Astapova I, Lee LJ, Morales C, Tauber S, Bilban M, & Hollenberg AN. The nuclear corepressor, NCoR, regulates thyroid hormone action in vivo. PNAS 2008 105 19544–19549. (https://doi.org/10.1073/pnas.0804604105)
- 28↑
Perissi V, Aggarwal A, Glass CK, Rose DW, & Rosenfeld MG. A corepressor/coactivator exchange complex required for transcriptional activation by nuclear receptors and other regulated transcription factors. Cell 2004 116 511–526. (https://doi.org/10.1016/s0092-8674(0400133-3)
- 29↑
Daniels G, Li Y, Gellert LL, Zhou A, Melamed J, Wu X, Zhang X, Zhang D, Meruelo D, Logan SK, et al.TBLR1 as an androgen receptor (AR) coactivator selectively activates AR target genes to inhibit prostate cancer growth. Endocrine-Related Cancer 2014 21 127–142. (https://doi.org/10.1530/ERC-13-0293)
- 30↑
Zekri Y, Guyot R, & Flamant F. An atlas of thyroid hormone receptors' target genes in mouse tissues. International Journal of Molecular Sciences 2022 23. (https://doi.org/10.3390/ijms231911444)
- 31↑
Ramadoss P, Abraham BJ, Tsai L, Zhou Y, Costa-e-Sousa RH, Ye F, Bilban M, Zhao K, & Hollenberg AN. Novel mechanism of positive versus negative regulation by thyroid hormone receptor beta1 (TRbeta1) identified by genome-wide profiling of binding sites in mouse liver. Journal of Biological Chemistry 2014 289 1313–1328. (https://doi.org/10.1074/jbc.M113.521450)
