Abstract
Background: Thyroid hemiagenesis, a rare congenital condition detected by ultrasound screening of the neck, is usually not manifested clinically in humans. This condition has been reported in mice with hypothyroidism associated with induced deficiency in paired box 8 and NK2 homeobox 1, sonic hedgehog, or T-box 1. Unexpectedly, we observed thyroid hemiagenesis in NOD.H2<sup>h4</sup> mice, an unusual strain that spontaneously develops iodide enhanced thyroid autoimmunity but remains euthyroid. Objectives and Methods: First, to compare mice with thyroid hemiagenesis versus bilobed littermates for serum T4, autoantibodies to thyroglobulin (ELISA) and thyroid peroxidase (TPO; flow cytometry with eukaryotic cells expressing mouse TPO), gross anatomy, and thyroid histology; second, to estimate the percentage of mice with thyroid hemiagenesis in the NOD.H2<sup>h4</sup> mice we have studied over 6 years. Results: Thyroid hemiagenesis was observed in 3 of 1,025 NOD.H2<sup>h4</sup> mice (2 females, 1 male; 0.3%). Two instances of hemiagenesis were in wild-type females and one in a transgenic male expressing the human TSHR A-subunit in the thyroid. Two mice had very large unilobed glands, as in some human cases with this condition. Thyroid lymphocytic infiltration, serum T4, and the levels of thyroid autoantibodies were similar in mice with thyroid hemiagenesis and bilobed littermates. Conclusions: Unlike hypothyroidism associated with hemiagenesis in transcription factor knockout mice, hemiagenesis in euthyroid NOD.H2<sup>h4</sup> mice occurs spontaneously and is phenotypically similar to that occasionally observed in humans.
Introduction
Thyroid hemiagenesis, comprising the absence of one thyroid lobe, is a rare congenital condition in humans. This condition is usually not manifested clinically and it is detected by ultrasound screening of the neck [1]. The prevalence of thyroid hemiagenesis was 0.05% in 24,032 school children in Sicily [2] and 0.02% in 299,908 children and young adults in a normal Japanese population [1]. In a recent meta-review, the prevalence was reported to vary from 0.05 to 0.5% [3]. There tended to be a bias toward the absence of the left lobe, especially in females, and sometimes enlargement of the single lobe [1, 2]. However, in other individuals, the single thyroid lobe was reduced in size [2]. In an unusual case of Graves’ disease, thyroid hemiagenesis was observed [4]. Individuals with thyroid hemiagenesis tended to develop other thyroid abnormalities but no common genetic basis was found for this condition [3].
In contrast to spontaneously occurring thyroid hemiagenesis in euthyroid humans, this condition in mice has only been reported in association with induced genetic defects leading to hypothyroidism. For example, this condition was reported in a relatively high proportion of mice with partial deficiencies in both paired box 8 (Pax8) and NK2 homeobox1 (TTF1), but not in strains deficient for only one of these transcription factors [5], as well as in mice lacking sonic hedgehog (Shh) [6]. In addition, T-box 1 (Tbx-1) null mice develop a small unilateral thyroid remnant resembling thyroid hemiagenesis [7].
Having excised very large numbers of thyroids from different mouse strains over many years, we were unaware of thyroid hemiagenesis until we began studying NOD.H2h4 mice, an unusual strain that spontaneously develops thyroid autoimmunity, including thyroid lymphocytic infiltration and autoantibodies to thyroglobulin (Tg) [8-10] and thyroid peroxidase (TPO) [11]. As with rarely occurring hemiagenesis with euthyroidism in humans, we report herein that NOD.H2h4 mice appear to be similarly predisposed to this syndrome.
Methods and Materials
Mice Studied
Wild-type NOD.H2h4 mice (originally from The Jackson Laboratory, Bar Harbor, ME, USA) and NOD.H2h4 mice expressing the human TSHR A-subunit transgene in their thyroids (hTSHR/NOD.H2h4) [12] were bred at Cedars-Sinai Medical Center. Transgenic NOD.H2h4 mice were genotyped by PCR for the human TSHR A-subunit (no cross-reactivity with the endogenous mouse TSHR) as shown in [13] and described below.
Mice were euthanized to harvest blood and thyroid glands (see below) in different experimental protocols after exposure (usually for 16 weeks) to regular drinking water or iodide supplemented drinking water (0.05% NaI) beginning in mice aged 8 weeks. In addition to iodide exposure, the experimental protocols included the following: injecting TSHR A-subunit protein [14]; exposure to diets containing variable amounts of selenium [15], and injecting gold nanoparticles coupled to mouse Tg or TSHR A-subunit protein (unpublished). In addition, some mice were the offspring of NOD.H2h4 crossed to BALB/c to generate F1 progeny, intercrossing F1 mice to generate F2, and back-crossing F1 males to NOD.H2h4 to generate N2 mice to determine the genetic basis for development of autoantibodies to mouse Tg (TgAb), autoantibodies to TPO (TPOAb) and thyroiditis [16], as well as transferring the human TSHR A-subunit transgene to the NOD.H2h4 strain by repeated backcrossing [12, 17]. It must be emphasized that all experimental protocols started when the mice were 8 weeks old, well beyond embryonic day 15.5 by which time the thyroid gland is fully developed [18].
Mice were fed Pico Lab Rodent Diet 20 containing 0.97 ppm iodide. All mouse studies were approved by the Institutional Animal Care and Use Committee at Cedars-Sinai Medical Center and conducted in accordance with mandated standards of humane animal care.
Genotyping of hTSHR.NOD.H2h4 Transgenics
DNA for genotyping was isolated from ear punches or tail tips using DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA). PCR amplification was performed for 40 cycles using the following primers: forward primer hTSHR 522 CTCCTGATGGCACTCGCAGGGTGGAGACGAAC; reverse primer hTSHR 755 GCCTGGAGAATCCCATGGACAGAGGAGCCTGG. As shown for the transgenic mouse later found to have thyroid hemiagenesis (online suppl. Fig. S1; for all online suppl. material, see online Supplementary Materials), the PCR gave a 460 base pair (bp) band for the human TSHR A-subunit in NOD.H2h4 transgenics, which was absent from wild-type mice.
Autoantibodies to Tg and TPO
TgAb were measured by ELISA (sera diluted 1: 100) and TPOAb by flow cytometry (sera diluted 1: 50) using mouse TPO-expressing Chinese hamster ovary cells. Both assays were performed as previously described [11].
Serum T4 and Thyroid Histology
T4 levels were measured (10 μL aliquots) by ELISA (Mouse/Rat Thyroxine (T4) ELISA, Calbiotech, El Cajon, CA, USA); data are reported as micrograms of thyroxine per deciliter.
Neck dissection was performed to reveal the thyroid glands as follows: Following a vertical skin incision in the neck and careful lateral displacement of the strap muscles, forceps were inserted behind the trachea to elevate and display the thyroid lobes. For mice with thyroid hemiagenesis and bilobed littermates, thyroid glands were preserved in zinc fixative (BD Pharmingen, San Diego, CA, USA), paraffin-embedded and serial sections stained with hematoxylin and eosin (IDEXX BioResearch Lab Animal and Biological Materials Diagnostic Testing, Columbia, MO, USA).
Results
In studying NOD.H2h4 mice over 6 years [12, 14-17, 19] and unpublished, we unexpectedly observed thyroid hemiagenesis in 3 of 1,025 mice euthanized at the age of 4 months (2 females, 1 male) (0.3%), one of which (the male) was photographed in situ (Fig. 1a). The appearance of thyroid hemiagenesis is similar to that shown by Amendola et al. [5] for mice with partial deficiencies in Titf1 and Pax8. Hemiagenesis occurred in 2 of 666 wild-type NOD.H2h4 mice (both females) and in 1 of 359 transgenic NOD.H2h4 mice with the TSHR A-subunit targeted to the thyroid (a male). The single thyroid lobe in the transgenic NOD.H2h4 mouse was not enlarged (Fig. 1a). In the 2 wild-type NOD.H2h4 mice, the single-lobe thyroids were very large relative to those in bilobed littermates and were not photographed but subjected to histological analysis.
Thyroid hemiagenesis (a) and normal thyroid (b) in NOD.H2h4 mice photographed in situ after neck dissection. Mice were exposed to iodide for 16 weeks from the age of 8 weeks and euthanized at the age of 6 months. Thy, thyroid; Tr, Trachea.
Citation: European Thyroid Journal 7, 4; 10.1159/000490700
Thyroid histology in 2 NOD.H2h4 mice with hemiagenesis was normal for this strain in terms of anticipated lymphocytic infiltration (Fig. 2a, b vs. c, d) and serum T4 levels were within the range of values in animals with 2 thyroid lobes (Fig. 3a). Similarly, the levels of TgAb and TPOAb for mice with a unilobed thyroid were comparable to those of their bilobed littermates (Fig. 3b, c). It should be noted that (as shown here), the degree of thyroiditis is variable in this strain and is related to the levels of TgAb [20].
Thyroid histology (hematoxylin and eosin) in 4 NOD.H2h4 mice, 2 with thyroid hemiagenesis (a, b) and 2 bilobed controls (c, d). Mice were 6 months old and had been exposed to iodide for 16 weeks. Magnification 10×.
Citation: European Thyroid Journal 7, 4; 10.1159/000490700
Serum T4, TgAb, and TPOAb in NOD.H2h4 mice with 1 thyroid lobe and their bi-lobed counterparts at the age of 6 months after 16 weeks on iodide supplementation. a T4 (μg /dL), b TgAb (OD in ELISA), and c TPOAb (geometric mean in flow cytometry). Controls (bilobed littermates) were treated in the same way and studied at the same time as the 3 mice with thyroid hemiagenesis. Data for the 3 cases of thyroid hemiagenesis are presented as filled black circles and for the bilobed littermate controls (n = 18) as box plots (median, 25th and 75th percentiles and, as error bars, the 10th and 90th percentiles; open circles show the values for outliers).
Citation: European Thyroid Journal 7, 4; 10.1159/000490700
It is unlikely that the thyroid hemiagenesis is caused by the autoimmune thyroiditis for several reasons: (a) thyroiditis takes time to develop and was studied in mice aged 4 months; (b) only 3 of 1,025 mice on the NOD.H2h4 background had thyroid hemiagenesis although all had TgAb, TPOAb, and thyroiditis; and (c) thyroid hemiagenesis was not observed in the related strain NOD.H2k that develops spontaneous thyroiditis and TgAb [21] but not TPOAb [19]. Colleagues who have had extensive experience with NOD.H2h4 mice, including wild-type and multiple immune cell or cytokine knockouts on the NOD.H2h4 background (all of which develop TgAb and thyroiditis) have not been aware of thyroid hemiagenesis (personal communications from Helen Braley Mullen, Molecular Microbiology and Immunology, University of Missouri School of Medicine, Columbia, MO, USA; Yuji Nagayama, Medical Gene Technology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan).
Finally, we have not previously observed thyroid hemiagenesis in other mouse strains which do not develop TgAb or TPOAb spontaneously (Table 1), including BALB/c [13, 22-27], C57BL/6 [27, 28], AKR/N [29-31], HLA-DR3, or DQ6 [32, 33] or recombinant inbred mice, namely CXB, BXH, AXB/BXA, BXD, and LXS [34-37]. Consequently, it is likely that thyroid hemiagenesis is strain specific.
Thyroid hemiagenesis in relation to the development of spontaneous (or iodide enhanced) thyroiditis, autoantibodies to Tg and TPO (TgAb and TPOAb) in the mouse strains we have studied
Discussion
We observed 3 cases of thyroid hemiagenesis in a total of 1,025 NOD.H2h4 mice, a strain in which all mice develop iodide-enhanced thyroid autoantibodies in association with thyroiditis. Thyroid hemiagenesis had not been noted by colleagues with extensive experience using NOD.H2h4 mice (personal communication) or by ourselves in 11 other mouse strains, including 5 commonly used strains (BALB/c, C56BL/6, DBA/2, and AKR/N). Unlike most other strains, NOD.H2h4 mice seem to be predisposed to developing thyroid hemiagenesis, consistent with the familial predisposition observed in some humans [3, 38].
Previously (as already mentioned), thyroid hemiagenesis was observed in some mice with knockouts of transcription factors Pax8, NK2 homeobox1 (Nkx-2/TTF-1), Shh, or Tbx1 [5-7], all mice being hypothyroid. Although we did not examine the expression of these factors in our NOD.H2h4 mice with hemiagenesis, deficiency in these factors is unlikely because all NOD.H2h4 mice (with or without thyroid hemiagenesis) were euthyroid. In addition, it is unlikely that the TSHR A-subunit transgene contributed to thyroid hemiagenesis in 1 mouse because (a) it occurred in 2 wild-type NOD.H2h4 mice and (b) the transgene is located on chromosome 1 [17] and not on chromosomes 2, 12, 5, and 16, the locations of Pax 8, TTF1, Shh, and Tbx1. It should be emphasized that the genetic basis for thyroid hemiagenesis in humans could be identified in only a minority of cases with no common or specific gene identified [3, 38], although thyroid autoimmunity was frequently present [39].
In conclusion, thyroid hemiagenesis occurs in a small percentage (0.3%) of NOD.H2h4 mice. Unlike hypothyroid transcription factor knockout mice, the outcome of thyroid hemiagenesis resembles that occasionally observed in humans (0.05–0.5%).
Acknowledgments
We thank Dr. Jean Ruf (INSERM-URA, Faculté de Médecine, Marseille, France) for generously providing us with mouse monoclonal antibodies to human TPO. This work was supported by the National Institutes of Health Grants DK54684 (S.M.M.) and DK19289 (B.R.).
Disclosure Statement
The authors have no conflicts of interest.
Footnotes
verified
References
- 1↑
Suzuki S, Midorikawa S, Matsuzuka T, Fukushima T, Ito Y, Shimura H, Takahashi H, Ohira T, Ohtsuru A, Abe M, Suzuki S, Yamashita S: Prevalence and Characterization of Thyroid Hemiagenesis in Japan: The Fukushima Health Management Survey. Thyroid 2017; 27: 1011–1016.
- 2↑
Maiorana R, Carta A, Floriddia G, Leonardi D, Buscema M, Sava L, Calaciura F, Vigneri R: Thyroid hemiagenesis: prevalence in normal children and effect on thyroid function. J Clin Endocrinol Metab 2003; 88: 1534–1536.
- 3↑
Szczepanek-Parulska E, Zybek-Kocik A, Wartofsky L, Ruchala M: Thyroid hemiagenesis: incidence, clinical significance, and genetic background. J Clin Endocrinol Metab 2017; 102: 3124–3137.
- 4↑
Baldini M, Orsatti A, Cantalamessa L: A singular case of Graves’ disease in congenital thyroid hemiagenesis. Horm Res 2005; 63: 107–110.
- 5↑
Amendola E, De Luca P, Macchia PE, Terracciano D, Rosica A, Chiappetta G, Kimura S, Mansouri A, Affuso A, Arra C, Macchia V, Di Lauro R, De Felice M: A mouse model demonstrates a multigenic origin of congenital hypothyroidism. Endocrinology 2005; 146: 5038–5047.
- 6↑
Fagman H, Grande M, Gritli-Linde A, Nilsson M: Genetic deletion of sonic hedgehog causes hemiagenesis and ectopic development of the thyroid in mouse. Am J Pathol 2004; 164: 1865–1872.
- 7↑
Fagman H, Liao J, Westerlund J, Andersson L, Morrow BE, Nilsson M: The 22q11 deletion syndrome candidate gene Tbx1 determines thyroid size and positioning. Hum Mol Genet 2007; 16: 276–285.
- 8↑
Rasooly L, Burek CL, Rose NR: Iodine-induced autoimmune thyroiditis in NOD-H2h4 mice. Clin Immunol Immunopathol 1996; 81: 287–292.
- 9
Braley-Mullen H, Sharp GC, Medling B, Tang H: Spontaneous autoimmune thyroiditis in NOD.H-2h4 mice. J Autoimmun 1999; 12: 157–165.
- 10↑
Hutchings PR, Verma S, Phillips JM, Harach SZ, Howlett S, Cooke A: Both CD4(+) T cells and CD8(+) T cells are required for iodine accelerated thyroiditis in NOD mice. Cell Immunol 1999; 192: 113–121.
- 11↑
Chen CR, Hamidi S, Braley-Mullen H, Nagayama Y, Bresee C, Aliesky HA, Rapoport B, McLachlan SM: Antibodies to thyroid peroxidase arise spontaneously with age in NOD.H-2h4 mice and appear after thyroglobulin antibodies. Endocrinology 2010; 151: 4583–4593.
- 12↑
Rapoport B, Aliesky HA, Banuelos B, Chen CR, McLachlan SM: A unique mouse strain that develops spontaneous, iodine-accelerated, pathogenic antibodies to the human thyrotrophin receptor. J Immunol 2015; 194: 4154–4161.
- 13↑
Pichurin PN, Chen CR, Chazenbalk GD, Aliesky H, Pham N, Rapoport B, McLachlan SM: Targeted expression of the human thyrotropin receptor A-subunit to the mouse thyroid: Insight into overcoming the lack of response to A-subunit adenovirus immunization. J Immunol 2006; 176: 668–676.
- 14↑
Rapoport B, Banuelos B, Aliesky HA, Hartwig Trier N, McLachlan SM: Critical differences between induced and spontaneous mouse models of Graves’ disease with implications for antigen-specific immunotherapy in humans. J Immunol 2016; 197: 4560–4568.
- 15↑
McLachlan SM, Aliesky H, Banuelos B, Que Hee SS, Rapoport B: Variable effects of dietary selenium in mice that spontaneously develop a spectrum of thyroid autoantibodies. Endocrinology 2017; 158: 3754–3764.
- 16↑
McLachlan SM, Lesage S, Collin R, Banuelos B, Aliesky HA, Rapoport B: Genes outside the Major Histocompatibility Complex Locus are linked to the development of thyroid autoantibodies and thyroiditis in NOD.H2h4 mice. Endocrinology 2017; 158: 702–713.
- 17↑
McLachlan SM, Aliesky HA, Banuelos B, Lesage S, Collin R, Rapoport B: High-level intrathymic thyrotrophin receptor expression in thyroiditis-prone mice protects against the spontaneous generation of pathogenic thyrotrophin receptor autoantibodies. Clin Exp Immunol 2017; 188: 243–253.
- 18↑
Fagman H, Nilsson M: Morphogenetics of early thyroid development. J Mol Endocrinol 2011; 46:R33–R42.
- 19↑
Pelletier AN, Aliesky HA, Banuelos B, Chabot-Roy G, Rapoport B, Lesage S, McLachlan SM: Evidence that MHC I-E dampens thyroid autoantibodies and prevents spreading to a second thyroid autoantigen in I-A NOD mice. Genes Immun 2015; 16: 268–274.
- 20↑
Burek CL, Talor MV: Environmental triggers of autoimmune thyroiditis. J Autoimmun 2009; 33: 183–189.
- 21↑
Damotte D, Colomb E, Cailleau C, Brousse N, Charreire J, Carnaud C: Analysis of susceptibility of NOD mice to spontaneous and experimentally induced thyroiditis. Eur J Immunol 1997; 27: 2854–2862.
- 22↑
Chen C-R, Pichurin P, Nagayama Y, Latrofa F, Rapoport B, McLachlan SM: The thyrotropin receptor autoantigen in Graves disease is the culprit as well as the victim. Journal of Clinical Investigation 2003; 111: 1897–1904.
- 23
Pichurin P, Aliesky H, Chen CR, Nagayama Y, Rapoport B, McLachlan SM: Thyrotrophin receptor-specific memory T cell responses require normal B cells in a murine model of Graves’ disease. Clin Exp Immunol 2003; 134: 396–402.
- 24
Chen C-R, Pichurin P, Chazenbalk GD, Aliesky H, Nagayama Y, McLachlan SM, Rapoport B: Low-dose immunization with adenovirus expressing the thyroid-stimulating hormone receptor A-subunit deviates the antibody response toward that of autoantibodies in human Graves’ disease. Endocrinology 2004; 145: 228–233.
- 25
Schwarz-Lauer L, Pichurin PN, Chen C-R, Nagayama Y, Paras C, Morris JC, Rapoport B, McLachlan SM: The cysteine-rich amino terminus of the thyrotropin receptor is the immunodominant linear antibody epitope in mice immunized using naked deoxyribonucleic acid or adenovirus vectors. Endocrinology 2003; 144: 1718–1725.
- 26
McLachlan SM, Nagayama Y, Pichurin PN, Mizutori Y, Chen CR, Misharin A, Aliesky HA, Rapoport B: The link between Graves’ disease and Hashimoto’s thyroiditis: A role for regulatory T cells. Endocrinology 2007; 148: 5724–5733.
- 27↑
Misharin A, Hewison M, Chen CR, Lagishetty V, Aliesky HA, Mizutori Y, Rapoport B, McLachlan SM: Vitamin D deficiency modulates Graves’ hyperthyroidism induced in BALB/c mice by thyrotropin receptor immunization. Endocrinology 2009; 150: 1051–1060.
- 28↑
Chen CR, Aliesky H, Pichurin PN, Nagayama Y, McLachlan SM, Rapoport B: Susceptibility rather than resistance to hyperthyroidism is dominant in a thyrotropin receptor adenovirus-induced animal model of Graves’ disease as revealed by BALB/c-C57BL/6 hybrid mice. Endocrinology 2004; 145: 4927–4933.
- 29↑
Jaume JC, Guo J, Wang Y, Rapoport B, McLachlan SM: Cellular thyroid peroxidase (TPO), unlike purified TPO and adjuvant, induces antibodies in mice that resemble autoantibodies in human autoimmune thyroid disease. J Clin Endocrinol Metab 1999; 84: 1651–1657.
- 30
Jaume JC, Rapoport B, McLachlan SM: Lack of female bias in a mouse model of autoimmune hyperthyroidism (Graves’ disease). Autoimmunity 1999; 29: 269–272.
- 31↑
Pichurin P, Schwarz-Lauer L, Braley-Mullen H, Paras C, Pichurina O, Morris JC, Rapoport B, McLachlan SM: Peptide scanning for thyrotropin receptor T-cell epitopes in mice vaccinated with naked DNA. Thyroid 2002; 12: 755–764.
- 32↑
Pichurin P, Chen CR, Pichurina O, David C, Rapoport B, McLachlan SM: Thyrotropin receptor-DNA vaccination of transgenic mice expressing HLA-DR3 or HLA-DQ6b. Thyroid 2003; 13: 911–917.
- 33↑
Pichurin PN, Pham N, David CS, Rapoport B, McLachlan SM: HLA-DR3 transgenic mice immunized with adenovirus encoding the thyrotropin receptor: T cell epitopes and functional analysis of the CD40 Graves’ polymorphism. Thyroid 2006; 16: 1221–1227.
- 34↑
Aliesky HA, Pichurin PN, Chen CR, Williams RW, Rapoport B, McLachlan SM: Probing the genetic basis for thyrotropin receptor antibodies and hyperthyroidism in immunized CXB recombinant inbred mice. Endocrinology 2006; 147: 2789–2800.
- 35
McLachlan SM, Aliesky HA, Pichurin PN, Chen CR, Williams RW, Rapoport B: Shared and unique susceptibility genes in a mouse model of Graves’ disease determined in BXH and CXB recombinant inbred mice. Endocrinol 2008; 149: 2001–2009.
- 36
McLachlan SM, Aliesky H, Chen C-R, Williams RW, Rapoport B: Exceptional hyperthyroidism and a role for both major histocompatibility class I and class II genes in a murine model of Graves’ disease. PLos One 2011; 6: e21378.
- 37↑
McLachlan SM, Aliesky H, Banuelos B, Magana J, Williams RW, Rapoport B: Immunoglobulin heavy chain variable region and major histocompatibility region genes are linked to induced graves’ disease in females from two very large families of recombinant inbred mice. Endocrinology 2014; 155: 4094–4103.
- 38↑
Castanet M, Leenhardt L, Leger J, Simon-Carre A, Lyonnet S, Pelet A, Czernichow P, Polak M: Thyroid hemiagenesis is a rare variant of thyroid dysgenesis with a familial component but without Pax8 mutations in a cohort of 22 cases. Pediatr Res 2005; 57: 908–913.
- 39↑
Szczepanek-Parulska E, Zybek-Kocik A, Wolinski K, Czarnocka B, Ruchala M: Does TSH trigger the anti-thyroid autoimmune processes? Observation on a large cohort of naive patients with thyroid hemiagenesis. Arch Immunol Ther Exp (Warsz) 2016; 64: 331–338.
